Informations

Isolement des granulés intacts des mastocytes

Isolement des granulés intacts des mastocytes



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Comment isoler les granules intacts des mastocytes sans utiliser de saccharose et de percoll ?


Les polyamines sont présentes dans les granules de sécrétion des mastocytes et sont importantes pour l'homéostasie des granules

Les granules de sécrétion des mastocytes contiennent un grand nombre de composants, dont beaucoup interagissent avec le protéoglycane de serglycine hautement sulfaté (PG) présent dans les granules. Les polyamines (putrescine, spermidine et spermine) sont absolument nécessaires à la survie de la grande majorité des cellules vivantes. Compte tenu de la capacité signalée des polyamines à interagir avec les PG, nous avons étudié la possibilité que les polyamines puissent être des composants des granules de sécrétion des mastocytes.

Méthodologie/Principaux résultats

La spermidine a été libérée par les mastocytes dérivés de la moelle osseuse de souris (BMMC) après dégranulation induite par les IgE/anti-IgE ou l'ionophore calcique A23187. De plus, la spermidine et la spermine ont été détectées dans des granules de mastocytes de souris isolés. En outre, l'épuisement des polyamines en cultivant des BMMC avec de la -difluorométhylornithine (DFMO) a provoqué une ultrastructure aberrante des granules de sécrétion, une altération du stockage de l'histamine, une réduction des niveaux de sérotonine et une augmentation de la teneur en β-hexosaminidase. Une approche protéomique a révélé que la déplétion en polyamines induite par le DFMO provoquait une altération des niveaux d'un certain nombre de protéines, dont beaucoup sont liées soit à l'exocytose régulée, soit au système endocytique.

Conclusions/Importance

Pris ensemble, nos résultats montrent que les polyamines sont présentes dans les granules de sécrétion des mastocytes et, en outre, indiquent un rôle essentiel de ces polycations au cours de la biogenèse et de l'homéostasie de ces organites.

Citation: García-Faroldi G, Rodríguez CE, Urdiales JL, Pérez-Pomares JM, Dávila JC, Pejler G, et al. (2010) Les polyamines sont présentes dans les granules de sécrétion des mastocytes et sont importantes pour l'homéostasie des granules. PLoS ONE 5(11) : e15071. https://doi.org/10.1371/journal.pone.0015071

Éditeur: David Holowka, Université Cornell, États-Unis d'Amérique

A reçu: 6 septembre 2010 Accepté: 19 octobre 2010 Publié : 30 novembre 2010

Droits d'auteur: © 2010 García-Faroldi et al. Il s'agit d'un article en libre accès distribué sous les termes de la Creative Commons Attribution License, qui permet une utilisation, une distribution et une reproduction sans restriction sur n'importe quel support, à condition que l'auteur original et la source soient crédités.

Le financement: Ce travail a été soutenu par les subventions SAF2008-02522 (Ministerio de Ciencia e Innovación, Espagne), P07-CVI-02999 et BIO-267 group (Junta de Andalucía, Espagne) et des fonds fournis par la Fundación Ramón Areces (Espagne). Il a également été aidé par l'action BM0806 de coopération européenne en science et technologie (COST), soutenue par le programme-cadre de l'Union européenne (UE) pour la recherche et le développement technologique (RDT). Le CIBER-ER est une initiative de l'Instituto de Salud Carlos III (Espagne). Les bailleurs de fonds n'ont joué aucun rôle dans la conception de l'étude, la collecte et l'analyse des données, la décision de publier ou la préparation du manuscrit.

Intérêts concurrents : Les auteurs ont déclaré qu'ils n'existaient pas de conflit d'intérêts.


Introduction

Les mastocytes sont des cellules importantes du système immunitaire et appartiennent à la lignée hématopoïétique. Les mastocytes proviennent de cellules progénitrices pluripotentes de la moelle osseuse et mûrissent sous l'influence du ligand c-kit et du facteur de cellules souches en présence d'autres facteurs de croissance distincts fournis par le microenvironnement du tissu où ils sont destinés à résider. Dans des conditions normales, les mastocytes matures ne circulent pas dans le sang. Cependant, les progéniteurs des mastocytes migrent dans les tissus et se différencient en mastocytes sous l'influence du facteur des cellules souches et de diverses cytokines. Les mastocytes sont présents dans tout le corps et ils jouent un rôle important dans le maintien de nombreuses fonctions physiologiques ainsi que dans la physiopathologie des maladies. En conséquence, cette revue se concentre sur le rôle des mastocytes dans un large éventail de fonctions physiologiques et la pathogenèse d'une variété d'états pathologiques.

Emplacement des mastocytes

Les mastocytes se trouvent dans les tissus muqueux et épithéliaux de tout le corps. Chez les rongeurs, les mastocytes résident également dans les cavités péritonéale et thoracique. Les mastocytes sont présents dans tous les tissus vascularisés à l'exception du système nerveux central et de la rétine (1). Les mastocytes sont situés au point de jonction de l'hôte et de l'environnement externe aux points d'entrée de l'antigène (tractus gastro-intestinal, peau, épithélium respiratoire) (1&# x020134). Les mastocytes sont situés dans les zones sous l'épithélium dans le tissu conjonctif entourant les cellules sanguines, les muscles lisses, les muqueuses et les follicules pileux.

Le cytoplasme du mastocyte contient 50&# x02013200 gros granules qui stockent des médiateurs inflammatoires, notamment de l'histamine, de l'héparine, une variété de cytokines, du sulfate de chondroïtine et des protéases neutres (1). Pour que les mastocytes migrent vers leurs emplacements cibles, les effets coordonnés des intégrines, des molécules d'adhésion, des chimiokines, des cytokines et des facteurs de croissance sont nécessaires (5). Les progéniteurs des mastocytes se trouvent en grand nombre dans l'intestin grêle. CXCR2 exprimé sur les progéniteurs des mastocytes dirige leur migration vers l'intestin grêle. La liaison des intégrines 㬔㬧 (exprimées sur les mastocytes) à la molécule d'adhésion VCAM-1 sur l'endothélium initie le transit des précurseurs des mastocytes hors de la circulation (5).

Les poumons n'ont pas beaucoup de progéniteurs de mastocytes dans un état physiologique normal. Lors d'une inflammation de l'endothélium respiratoire induite par l'antigène, les progéniteurs des mastocytes sont recrutés en engageant les intégrines 㬔㬧, VCAM-1 et CXCR2. De plus, CCR-2 et CCL-2 sont impliqués dans le recrutement de progéniteurs de mastocytes dans l'endothélium respiratoire. Lorsque les mastocytes matures sont activés et dégranulés, davantage de progéniteurs de mastocytes sont recrutés sur le site de l'inflammation (5).

Il existe deux phénotypes de mastocytes humains : les mastocytes muqueux qui ne produisent que de la tryptase et les mastocytes du tissu conjonctif qui produisent de la chymase, de la tryptase et des carboxypeptidases (6, 7). L'activation des mastocytes et la libération du médiateur ont des effets différents dans divers tissus et organes. Les sites corporels les plus fréquemment exposés aux antigènes sont la muqueuse des voies respiratoires (par voie aérienne), le tractus gastro-intestinal (par voie alimentaire), le sang (plaies, absorption par les voies respiratoires/tractus gastro-intestinal) et les tissus conjonctifs (8).

Lorsque le tractus gastro-intestinal est exposé à un antigène, sa réponse est d'augmenter la sécrétion de liquide, d'augmenter la contraction des muscles lisses et d'augmenter le péristaltisme. Les protéines dérivées de différentes plantes et animaux peuvent agir comme des antigènes et activer le système immunitaire chez les sujets vulnérables (8). L'antigène (peptide) traverse la couche épithéliale de la muqueuse intestinale et se lie aux IgE des mastocytes muqueux. Ces peptides sont présentés aux cellules Th2, et s'il y a un anticorps IgE contre le peptide présent, il provoquera l'activation du mastocyte entraînant une réponse immunitaire. Cela provoque la dégranulation des mastocytes et la libération d'une variété de médiateurs inflammatoires. Ces médiateurs augmentent la perméabilité vasculaire, provoquant un œdème de l'épithélium intestinal et une contraction des muscles lisses, qui entraînent des vomissements et des diarrhées. Ce type de réaction peut survenir en réponse aux peptides présents dans certains médicaments. Les allergènes alimentaires peuvent également provoquer des réactions cutanées. L'absorption par le tractus gastro-intestinal peut introduire des antigènes dans le sang, qui sont transportés dans tout le corps où ils se lient aux IgE sur les mastocytes dans le tissu conjonctif dans les couches profondes de la peau. Cela se traduit par une réaction urticarienne et un œdème de Quincke (8).

Dans les voies respiratoires, la réponse immunitaire à l'activation des mastocytes entraîne une constriction des voies respiratoires, une augmentation de la production de mucus et une toux (1). L'introduction la plus courante d'antigènes dans les voies respiratoires se fait par inhalation. Les mastocytes de la muqueuse de l'épithélium nasal sont activés par des antigènes qui diffusent à travers la muqueuse après avoir été inhalés. Dans les voies respiratoires, la dégranulation des mastocytes augmente la perméabilité vasculaire et l'œdème local, ce qui peut obstruer les voies respiratoires nasales et entraîner une congestion (9, 10). Il y a une production accrue de mucus et son accumulation peut bloquer les sinus et entraîner une infection bactérienne. Les mastocytes jouent également un rôle central dans la physiopathologie de l'asthme allergique. Ceci est causé par une réponse inflammatoire dans les voies respiratoires, qui résulte des antigènes inhalés qui pénètrent dans les voies respiratoires inférieures et provoquent une dégranulation des mastocytes et une inflammation locale. Ces événements entraînent une augmentation de la perméabilité vasculaire, une accumulation de liquide et un œdème, qui peuvent obstruer les voies respiratoires. Une constriction bronchique peut survenir en raison de la contraction des muscles lisses, ce qui peut entraîner une obstruction des voies respiratoires observée dans l'asthme. L'air est donc piégé et la capacité pulmonaire totale est augmentée tandis que le volume expiratoire forcé en 1 & 02009s (VEMS) et la capacité vitale forcée (CVF) sont diminués (8). Dans les vaisseaux sanguins, une perméabilité vasculaire accrue entraîne un œdème et une inflammation locale, ce qui entraîne le transport de l'antigène vers les ganglions lymphatiques (11).

Dans la peau, les antigènes, via les IgE, activent les mastocytes dans les couches profondes du tissu conjonctif. Les mastocytes libèrent de l'histamine ainsi que d'autres molécules vasoactives, qui provoquent l'urticaire (urticaire). Si l'antigène active les mastocytes dans les tissus plus profonds, cela peut entraîner un œdème de Quincke. Si la réponse est prolongée, une dermatite atopique ou un eczéma peuvent survenir. L'eczéma est vu cliniquement comme une éruption cutanée chronique avec démangeaisons avec des lésions surélevées et un écoulement de liquide. L'eczéma est plus fréquemment observé pendant l'enfance, tandis que la rhinite allergique et l'asthme sont observés tout au long de la vie (8).

Mécanisme d'activation

Les mastocytes sont connus pour leur principal mécanisme d'action : les réactions allergiques médiées par les IgE via le récepteur FcϵRI. Les anticorps IgE sont produits par les cellules B matures en réponse aux cellules CD4+ Th2. Toutes les cellules B matures produisent des anticorps IgM et IgD. Une fois activés par un antigène, les lymphocytes B prolifèrent. Si ces cellules B interagissent avec des cytokines, telles que l'IL-4 (qui est modulée par les cellules CD4+ Th2), la classe d'anticorps passe des IgM aux IgE (12). Les IgE se trouvent principalement liées aux récepteurs FcϵRI sur le mastocyte, et très peu d'IgE se trouvent sous forme d'anticorps solubles dans la circulation. Lorsqu'un antigène entre en contact avec le mastocyte, il réticule deux molécules Fc ou plus et active la libération de granules par le mastocyte (13). Les IgE se trouvent dans le tissu conjonctif sous les couches épithéliales de la peau, dans les voies respiratoires et également dans le tractus gastro-intestinal (1). En plus de FcϵRI, les mastocytes expriment également des récepteurs Fc pour IgA et IgG, des récepteurs pour l'adénosine, C3a, des chimiokines, des cytokines et des modèles moléculaires associés aux agents pathogènes (PAMP), ainsi que des récepteurs de type péage (TLR), tous dont sont impliqués dans l'activation des mastocytes et la réponse immunitaire.

La voie physiologique la plus courante pour l'activation des mastocytes est via la réticulation antigène/IgE/FcϵRI (14). FcϵRI se compose d'une chaîne α qui se lie aux IgE, d'une chaîne β qui traverse la membrane et de chaînes γ, qui sont un homodimère à liaison disulfure. FcϵRI interagit avec la tyrosine kinase LYN, qui phosphoryle la tyrosine dans ses motifs d'activation des bases immunoréceptrices de la tyrosine (ITAM) sur les chaînes B et γ du FcϵRI (15). Lyn active les tyrosine kinases Syk, qui phosphorylent les protéines de signalisation, telles que LAT1 et LAT2 (linkers pour l'activation des cellules T) (16). Le PLC phosphorylé hydrolyse le phosphatidylinositol-4,5-bisphosphate pour produire l'inositol-1,4,5-triphosphate (IP3) et le diacylglycérol (DAG). IP3 et DAG sont des seconds messagers et IP3 provoque la mobilisation du calcium du réticulum endoplasmique (17). La libération de calcium active et provoque la translocation de NF㮫 vers le noyau de la cellule, ce qui entraîne la transcription de cytokines, telles que IL-6, TNFα et IL-13. Zeb2 est impliqué dans la régulation de la dégranulation lors de la stimulation via Fc&# x003f5RI (18). L'activation de FcϵRI active Fyn (Src kinase). Fyn régule la dégranulation des mastocytes, qui est complémentaire à la voie de signalisation Lyn. Fyn active PI3K, qui active Akt et produit PIP3 (15). Cela active mTOR, qui est impliqué dans la chimiotaxie des mastocytes et la production de cytokines (14). Il existe également des récepteurs pour les IgG appelés FcγR. L'homodimère de la chaîne Y est le même dans FcγRI que dans FcϵRI, de sorte que le signal envoyé par FcγR peut se croiser avec FcϵRI (14). L'exposition répétée et contrôlée des mastocytes à l'antigène peut désensibiliser la sensibilité d'un patient. Bien que les mécanismes ne soient pas clairement compris, la dégranulation lente et persistante des mastocytes est considérée comme l'un des mécanismes. Le protocole de désensibilisation est utilisé chez les patients allergiques à certains médicaments (par exemple, la pénicilline) mais qui ont besoin d'un traitement pour une infection bactérienne potentiellement mortelle qui ne peut être traitée qu'avec ce médicament.

Une désensibilisation des mastocytes peut survenir suite à une exposition à des doses croissantes d'antigène. Cette technique peut être utilisée si un patient est allergique à un médicament nécessaire et prévenir les réactions anaphylactiques aux aliments. En désensibilisant les récepteurs, cela peut diminuer le nombre de molécules FcϵRI disponibles à la surface des mastocytes (19).


Isolement et caractérisation des granules corticaux associés à la membrane plasmique à partir d'œufs d'oursins

Des granules corticaux, qui sont des organites sécrétoires spécialisés trouvés dans les ovules de nombreux organismes, ont été isolés des œufs des oursins Arbacia punctulata et Strongylocentrtus pupuratus par une procédure simple et rapide. L'examen au microscope électronique des granules corticaux préparés par cette procédure révèle qu'ils sont étroitement attachés à de grands segments de la membrane plasmique et de sa couche vitelline associée. Une preuve supplémentaire que les granules corticaux étaient associés à ces couches de surface cellulaire a été obtenue par des techniques de marquage au (125)I. Les préparations de granules corticaux se sont avérées riches en protéoestérase, qui a été purifiée 32 fois par rapport à celle détectée dans un homogénat brut. De même, la radioactivité spécifique d'une glycoprotéine de surface marquée au 125I a été multipliée par 40. Ces faits, couplés à des observations au microscope électronique, indiquent que la procédure d'isolement donne une préparation dans laquelle les granules corticaux et la membrane plasmique-couche vitelline sont purifiés dans la même mesure. L'électrophorèse sur gel de la préparation de granules corticaux associée à la membrane révèle la présence d'au moins huit polypeptides. Le polypeptide principal, qui est une glycoprotéine de poids moléculaire apparent de 100 000, contient la majeure partie de la radioactivité introduite par le marquage au 125I des œufs intacts. La lyse des granules corticaux est observée dans des conditions hypotoniques, ou dans des conditions isotoniques si l'ion Ca(2+) est présent. Lorsque la lyse est dans des conditions isotoniques est induite par l'ajout d'ions Ca(2+), les contenus denses aux électrons des granules restent insolubles. En revanche, la lyse hypotonique entraîne la libération du contenu du granule sous une forme soluble. Cependant, dans les deux cas, la glycoprotéine marquée au (125)I reste insoluble, probablement parce qu'elle est un composant de la membrane plasmique ou de la couche vitelline. Tous ces résultats indiquent qu'à l'aide de cette préparation purifiée, il devrait être possible de mener des études in vitro pour mieux définir certains des événements initiaux liés à la surface observés in vivo lors de la fécondation.


Résumé

Objectif- Des études récentes ont mis en évidence l'importance pathogénique de l'inflammation chronique dans les troubles cardiovasculaires tels que l'insuffisance cardiaque congestive et l'athérosclérose. Les mastocytes libèrent une grande variété de médiateurs immunitaires qui peuvent initier des réponses inflammatoires, tandis que les cellules endothéliales (CE) jouent un rôle de premier plan dans la pathogenèse des maladies cardiovasculaires en sécrétant des cytokines. Le but de cette étude était de clarifier le rôle des mastocytes en tant qu'activateur des CE.

Méthodes et résultats— Les CE récoltées dans les veines du cordon ombilical humain ont été stimulées avec des granules de mastocytes (MCG) préparés à partir de mastocytes leucémiques humains soniqués. Les surnageants et l'ARN total des cellules ont été collectés. Les niveaux d'interleukine (IL)-1β, de facteur de nécrose tumorale-α et de facteur de stimulation des colonies de granulocytes sont restés inchangés jusqu'à 24 heures. En revanche, les niveaux de protéine chimiotactique des monocytes-1 (MCP-1) et d'IL-8 ont augmenté de manière significative dans les 6 heures. L'analyse par transfert de Northern a révélé une augmentation de l'expression de l'ARNm de MCP-1 et IL-8 dans les CE traitées par MCG. L'induction de ces chimiokines a été atténuée par l'anticorps neutralisant antitryptase. De plus, MCP-1 et IL-8 ont été induits dans les CE par incubation avec de la tryptase mastocytaire humaine, mais pas avec de la chymase.

Conclusion— Ces résultats indiquent que la production de MCP-1 et d'IL-8 dans les CE a été induite par le MCG et amplifiée par la tryptase.

Le rôle des mastocytes dans la pathogenèse des troubles cardiovasculaires a été récemment mis en évidence. Cependant, le mécanisme reste flou. Cette étude démontre que la dégranulation des mastocytes provoque la production de chimiokines dans les cellules endothéliales. Ces observations suggèrent le lien entre les mastocytes et l'athérosclérose via la production endothéliale de chimiokine.

Des études récentes ont montré que l'infection chronique, l'inflammation et les facteurs immunologiques sont étroitement associés au développement de certains troubles cardiovasculaires. L'inflammation chronique augmente le nombre de macrophages et de lymphocytes T dans les lésions athéroscléreuses. 1 La progression des lésions peut également être associée à une augmentation des concentrations plasmatiques de protéine C réactive, un marqueur d'inflammation considéré comme un signe précoce d'athérosclérose. 2 La réponse immunitaire à une infection virale peut être une source majeure de cardiomyopathie dilatée. L'équilibre entre les cytokines inflammatoires et anti-inflammatoires joue un rôle central dans le développement de l'insuffisance cardiaque et des lésions athéroscléreuses. Les protéines chimioattractantes (chimiokines) se trouvent dans les athéromes humains 3,4 et les souris dépourvues de chimiokines ou de leurs récepteurs sont moins sujettes à l'athérosclérose. 5-8 De plus, nous avons montré que l'expression de la protéine chimiotactique des monocytes-1 (MCP-1) est augmentée dans le cœur hypertrophié et défaillant surchargé de pression. 9

Les mastocytes sont des cellules effectrices résidentes essentielles dans le déclenchement de la réponse immunitaire, présentes dans presque tous les organes principaux, près des vaisseaux sanguins en particulier. 10 Des études récentes ont suggéré que les mastocytes jouent un rôle dans la progression de l'insuffisance cardiaque, de l'athérosclérose et de la rupture de l'athérome. 11-13

Les mastocytes sont généralement périvasculaires et peuvent réguler la fonction des cellules endothéliales (CE). Les CE sont une source majeure de diverses molécules bioactives, notamment des cytokines et des chimiokines. Cette étude a testé l'hypothèse que la dégranulation des mastocytes par certains stimuli peut réguler la production de cytokines à partir des CE et participer au développement de l'insuffisance cardiaque et des lésions athéroscléreuses.

Méthodes

Produits biochimiques et autres matériaux

Milieu199 (M-199), sel de sodium d'héparine de grade I-A de muqueuse intestinale porcine, solution de tryptase humaine, N-benzoyle-,L-arginine-p-nitroanilide (BAPNA), et N-succinyl-L-Ala-L-Ala-L-Pro-L-Phe-p-nitroanilide (SAAPP) ont été achetés auprès de Sigma Chemical Co (St Louis, Mo). La chymase humaine recombinante a été obtenue auprès de Teijin Ltd (Osaka, Japon), et le SF-8257 provenait de Suntory Biomedical Research Ltd (Osaka, Japon). Le sérum de veau foetal et la trypsine/EDTA ont été obtenus auprès de Life Technologies Inc (Grand Island, NY). Des kits de dosage immuno-enzymatique spécifiques pour l'interleukine (IL)-1β, le facteur de nécrose tumorale-α, le facteur de stimulation des colonies de granulocytes et le facteur de stimulation des colonies de macrophages de granulocytes ont été achetés auprès d'Otsuka Pharmaceutical Co (Tokushima, Japon), et des kits pour MCP-1 et IL-8 provenaient de Toray Industries Inc (Tokyo, Japon). L'anticorps neutralisant contre la tryptase a été purifié comme décrit précédemment. 14,15

Culture de cellules

Les CE ont été isolées de veines ombilicales humaines comme décrit précédemment 16 et cultivées dans du M-199 supplémenté avec 20 % de sérum de veau foetal inactivé par la chaleur, 90 g/mL d'héparine et des antibiotiques (pénicilline, 50 U/mL de streptomycine, 50 g/mL et amphotéricine B, 125 ng/mL). Les cellules des passages 3 ou 4 ont été ensemencées sur des plaques de culture recouvertes de 0,5% de gélatine et incubées à 37°C dans une atmosphère humidifiée de 5% de CO2/95% d'air. Après que la monocouche soit devenue confluente, le milieu de culture a été remplacé par du M-199 avec 5 % de sérum de veau foetal inactivé par la chaleur, et les cellules ont été incubées pendant une nuit et des granules de mastocytes (MCG) ont été ajoutés. Les CE ont été identifiées par leur aspect typique de « pavé » et la coloration de l'antigène du facteur VIII par immunofluorescence. La lignée de mastocytes humains 1 (HMC-1) (un cadeau aimable de JH Butterfield, Mayo Clinic, Rochester, Minn) a été cultivée dans le milieu Dulbecco modifié d'Iscove (Life Technologies, Grand Island, NY) avec 10 % de sérum de veau foetal inactivé par la chaleur , 4 mmol/L l -glutamine et antibiotiques (pénicilline, 50 U/mL streptomycine, 50 g/mL et amphotéricine B, 125 ng/mL) dans une atmosphère humidifiée à 5 % de CO2/95% d'air. Le nombre de cellules a été ajusté à 5 x 106 cellules/mL deux fois par semaine en ajoutant du milieu frais.

Préparation des MCG

Les MCG ont été préparés comme décrit précédemment. 17 En bref, dans des conditions stériles, les MCG ont été obtenus par sonication en bain dans la glace pendant 5 secondes à partir de HMC-1 (5 x 10 6 cellules/mL) en suspension dans du milieu de culture. Le produit aux ultrasons a ensuite été microcentrifugé (5 minutes) à 4°C, et les surnageants sans débris ont été aliquotés et stockés à -80°C. Cette solution a été utilisée comme MCG puis ajoutée à des cellules endothéliales de veine ombilicale humaine (CE) incubées dans une plaque à 24 puits. Pour confirmer que des activités enzymatiques existent dans la procédure de préparation de MCG, nous avons mesuré l'activité de la tryptase et de la chymase comme décrit précédemment. 18 L'activité de la tryptase a été déterminée par sa capacité à cliver un substrat synthétique N-benzoyle-,L-arginine-p-nitroanilide (BAPNA) 2 mmol/L dans Tris-HCl 0,1 mol/L (pH 8,0) et glycérol 1mol/L à 410 nm. L'activité de la chymase a été déterminée par spectrophotométrie (410 nm) par la vitesse d'hydrolyse de N-succinyl-L-Ala-L-Ala-L-Pro-L-Phe-p-nitroanilide (SAAPP) 0,7 mmol/L dans NaCl 1,5mol/L et Tris 0,3mol/L (pH 8,0). L'activité protéasique a été exprimée en milliunités par millilitre (mU/mL), dans lesquelles 1 U d'activité enzymatique a été définie comme la quantité dégradant 1 mol de substrat par minute à 25°C. L'activité tryptase des préparations de MCG utilisées dans la présente étude était de 12,62 mU/mL et l'activité de la chymase était de 3,81 mU/mL.

Protocoles expérimentaux

Mesure de la production de cytokines par les cellules endothéliales

Les CE, à une densité de 500 cellules/mm 2 , ont été incubées en milieu complet et laissées adhérer dans une plaque de 24 puits pendant 48 heures. Le milieu a ensuite été remplacé par du M-199 avec 5 % de sérum de veau foetal inactivé par la chaleur pendant une période de 24 heures. Des MCG ont ensuite été ajoutés jusqu'à 24 heures. Les concentrations d'IL-1β, de facteur de nécrose tumorale-α, d'IL-8, de MCP-1, de facteur de stimulation de colonie de granulocytes et de facteur de stimulation de colonie de macrophages de granulocytes dans le surnageant ont été mesurées par dosage immuno-enzymatique et comparées à celles de cellules témoins exposées à la solution de HMC-1 pendant la même durée, cependant, sans sonication préalable.

Isolement d'ARN et hybridation Northern Blot

L'ARN total a été isolé par la procédure au thiocyanate de guanidinium-phénol-chloroforme-alcool isoamylique à partir de CE incubées avec du MCG pendant 0, 1, 6 ou 24 heures, et une analyse par transfert de Northern a été effectuée. 19 Des quantités égales d'ARN ont été soumises à une électrophorèse sur un gel d'agarose/formaldéhyde à 1,2 % et transférées sur une membrane en nylon (Hybond-N+ Amersham Corp, Bunckinghamshire, Angleterre) par des procédures standard. 20 Les transferts ont été séquentiellement hybridés avec des sondes d'ADNc marquées à l'alpha-32P-dCTP pour la MCP-1 et l'IL-8 humaines. Après une nuit d'hybridation, les membranes ont été lavées avec 2 x SSPE/0,1 % SDS à température ambiante, 1 x SSPE/0,1 % SDS à 65°C et 0,1 x SSPE/0,1 % SDS à 65°C. Les transferts ont été analysés avec un analyseur de bio-imagerie FUJIX BAS 2000 (Fujix, Tokyo, Japon) et normalisés au niveau d'ARNr 18S correspondant.

Rôles de la tryptase et de la chymase sur l'expression génique induite par le MCG et la production de MCP-1 et IL-8

Dans une série d'expériences, un anticorps neutralisant antitryptase, une IgG de contrôle non immunisée ou l'inhibiteur sélectif de la chymase SF-8257 ont été ajoutés au milieu de culture 1 heure avant la stimulation du MCG pour étudier le rôle de la tryptase et de la chymase dans la production de MCP-1 induite par le MCG. et IL-8. L'anticorps antitryptase a été utilisé à des concentrations de 0,001 à 10 g/mL, les IgG de contrôle à 10 g/mL et le SF8257 à des concentrations de 10 -7 à 10 -5 mol. Le SF8257 s'est avéré efficace à une concentration de 10 -5 mol.

Effets de la tryptase et de la chymase sur la production de MCP-1 et d'IL-8

Les CE, à une densité de 500 cellules/mm 2 , ont été incubées en milieu complet et laissées adhérer dans une plaque de 24 puits pendant 48 heures. Le milieu a ensuite été remplacé par du M-199 avec 5 % de sérum de veau foetal inactivé par la chaleur pendant 24 heures. De la tryptase à des concentrations de 0,3 à 3 g/mL ou de la chymase à des concentrations de 0,3 à 3 g/mL ont ensuite été ajoutées et les cellules ont été cultivées jusqu'à 24 heures.

Analyses statistiques

Les valeurs sont présentées sous forme de moyenne ± SEM. Les résultats ont été analysés par des étudiants non appariés t test ou par analyse de variance. P<0,05 a été considéré comme significatif.

Résultats

Libération de cytokines induite par le MCG

La figure 1 montre les niveaux moyens de cytokines mesurés par dosage immuno-enzymatique dans 3 expériences distinctes. Les niveaux d'IL-1β, du facteur de nécrose tumorale-α, du facteur de stimulation des colonies de granulocytes et du facteur de stimulation des colonies de macrophages de granulocytes n'ont pas été modifiés par la MCG. En revanche, les niveaux de MCP-1 et IL-8 ont augmenté de manière significative par l'ajout de MCG par rapport aux cultures témoins. Les taux de MCP-1 et d'IL-8 des CE stimulés par le MCG pendant 24 heures étaient respectivement de 1,6 ± 0,1 fois (P<0,05) et 16,4±0,3 fois (P<0,05) supérieures à celles des cellules maintenues statiques pendant 24 heures. L'augmentation de la production de MCP-1 et d'IL-8 dans les CE par le MCG était apparente dans les 6 heures (figure 2).

Figure 1. Effet des MCG sur la production de cytokines par les CE. Des CE vasculaires ombilicales humaines (HUVEC) ont été cultivées dans le milieu 199 en présence ou en absence de MCG pendant 24 heures et la concentration de chaque cytokine dans les surnageants a été mesurée. Les valeurs sont moyennes ± SEM (n=3). *P<0,05 par rapport aux témoins.

Figure 2. Effet dépendant du temps des MCG sur la production de MCP-1 et d'IL-8. Les HUVEC ont été cultivées dans un milieu complet 199 en présence ou en l'absence de MCG pendant 0, 1, 6 et 24 heures, et la concentration de MCP-1 ou d'IL-8 dans les surnageants a été mesurée. Les valeurs sont moyennes ± SEM (n=3). *P<0,05 par rapport aux témoins.

Effets du MCG sur l'expression génique de MCP-1 et IL-8

La figure 3 est un transfert de Northern représentatif montrant l'évolution dans le temps des niveaux d'ARNm de MCP-1 et IL-8. Le niveau d'ARNm de MCP-1 a augmenté en 1 heure, a culminé à 6 heures et est resté significativement augmenté à 24 heures. L'analyse densitométrique du niveau d'ARNm de MCP-1 normalisé par rapport à l'ARNr 18S a montré une augmentation de 2,2 ± 0,3 fois des CE stimulées par MCG à 6 heures par rapport aux témoins statiques. Le niveau d'ARNm d'IL-8 a également augmenté à 1 heure, a culminé à 6 heures, puis est revenu vers la ligne de base. L'analyse densitométrique du niveau d'ARNm d'IL-8 normalisé par rapport à l'ARNr 18S a montré une augmentation de 2,4 ± 0,4 fois des CE stimulées par le MCG exposées au MCG pendant 6 heures par rapport aux témoins statiques. Les niveaux d'ARNm de MCP-1 et IL-8 des contrôles non stimulés par le MCG n'ont montré aucun changement significatif dans les 6 heures (Figure I, disponible en ligne sur http://atvb.ahajournals.org).

Figure 3. Effet dépendant du temps des MCG sur l'expression des gènes de MCP-1 et IL-8. Les ARN totaux ont été isolés des CE incubées avec des MCG pendant 0, 1, 6 ou 24 heures, et une analyse par transfert de Northern a été réalisée. Les transferts ont été séquentiellement hybridés avec des sondes d'ADNc pour MCP-1 et IL-8 humaines. Les bandes d'ARNr 18S correspondantes sont présentées comme témoins internes. Les valeurs sont moyennes ± SEM (n=3). *P<0.05 par rapport aux contrôles statiques.

Rôles de la tryptase et de la chymase sur l'expression génique induite par le MCG et la production de MCP-1 et IL-8

Parce que les mastocytes contiennent une variété de médiateurs, y compris des protéases, des protéoglycanes et de l'histamine, qui pourraient stimuler les CE à produire des chimiokines, une tentative a été faite pour identifier le facteur qui a causé la production de MCP-1 et IL-8. Le traitement des CE avec un anticorps polyclonal contre la tryptase à 1 g/mL a inhibé la production induite par le MCG de MCP-1 et IL-8 (figure 4A). L'analyse Northern blot a montré que l'inactivation de la tryptase par l'anticorps antitryptase, 1 g/mL, inhibait l'expression génique induite par le MCG de MCP-1×48±16%, et de IL-8×74±19% (P<0,05 par rapport aux témoins non traités Figure 4B Figure II, disponible en ligne sur http://atvb.ahajournals.org). Les mêmes concentrations d'IgG polyclonale non immunitaire n'ont modifié ni l'expression génique induite par le MCG ni la production de protéines de MCP-1 et IL-8 par le MCG. De plus, l'inhibition sélective de la chymase par le SF-8257, 10 -5 mol n'a pas diminué la production induite par le MCG de MCP-1 et IL-8 (Figure 4C). Ces résultats suggèrent que la tryptase, mais pas la chymase, joue un rôle essentiel dans l'expression génique induite par le MCG de MCP-1 et IL-8.

Figure 4. Rôles de la tryptase et de la chymase sur l'expression génique induite par le MCG et la production de MCP-1 et IL-8. Les CE ont été prétraitées avec un anticorps neutralisant tryptase (0,001 à 10 g/mL) (A) et SF-8257 (10 -7 à 10 -5 mol/L) (C), un inhibiteur de la chymase, chacun pendant 1 heure avant l'exposition des CE aux MCG pendant 24 heures pour l'analyse des niveaux de protéines et pendant 6 heures pour l'examen des expressions géniques (B). Les valeurs sont moyennes ± SEM (n=3). *P<0,05 par rapport aux témoins. Les bandes d'ARNr 18S correspondantes sont présentées comme témoins internes.

Effets de la tryptase et de la chymase sur la production de MCP-1 et d'IL-8

La tryptase a considérablement augmenté les productions de MCP-1 et d'IL-8 dans les CE dans les 6 heures suivant l'exposition (figure 5A). Il y avait des libérations dose-dépendantes de MCP-1 et d'IL-8 des CE sur une gamme de concentrations de tryptase. En revanche, la chymase n'a pas modifié l'induction de MCP-1 et IL-8 (figure 5B).

Figure 5. Effet dépendant du temps et de la dose des protéases sur la production de MCP-1 et IL-8. Les CE ont été incubées dans un milieu complet laissé adhérer pendant 48 heures, puis le milieu a été remplacé par du milieu 199 avec 5 % de sérum de veau foetal inactivé par la chaleur pendant une période de 24 heures. De la tryptase à des concentrations de 0,3 à 3 g/mL ou de la chymase à des concentrations de 0,3 à 3 g/mL ont ensuite été ajoutées et les cellules ont été cultivées jusqu'à 24 heures. Les valeurs sont moyennes ± SEM (n=3). *P<0,05 par rapport aux témoins.

Discussion

Cette étude indique que les MCG induisent la production par les CE humaines de MCP-1, un puissant chimiotactique pour les monocytes, et d'IL-8, un puissant chimiotactique pour les neutrophiles, les lymphocytes T et les éosinophiles. Ces effets ont été médiés par la tryptase des mastocytes humains. Le rôle des mastocytes dans la pathogenèse des troubles cardiovasculaires, de l'insuffisance cardiaque et de l'athérosclérose en particulier, a été récemment mis en évidence. Le nombre de mastocytes est augmenté dans le cœur humain défaillant 11 et dans le myocarde de rat récemment infarci 21, avec une augmentation de leurs médiateurs tels que la tryptase et l'histamine. Nous avons déjà montré que les MCG provoquent l'apoptose des cardiomyocytes et la prolifération des fibroblastes cardiaques in vitro. 12 De plus, dans les artères coronaires liées à l'infarctus, le nombre de mastocytes dégranulés dans l'adventice supportant les plaques rompues est augmenté. 13 Ces observations suggèrent que les mastocytes et la tryptase des mastocytes sont activés dans les cœurs défaillants et dans les lésions athéroscléreuses.

Les chimiokines agissent principalement sur les neutrophiles, les monocytes, les lymphocytes et les éosinophiles et jouent un rôle central dans le système immunitaire. 22–26 The study of chemokines has recently expanded to fields well beyond immunology, and it has become evident that they play key roles in cardiovascular diseases. 27,28 MCP-1, a chemotactic factor for monocytes and one of the C-C chemokines, is believed to be among the important molecules involved in atherogenesis 5 and heart failure. 9 We have previously reported that plasma levels of MCP-1 are also increased in patients with acute myocardial infarction 29 and have shown that antibody against MCP-1 reduces myocardial infarct size in a rat ischemia/reperfusion model. 30 These data suggérer that MCP-1, as an inflammatory mediator, plays a pivotal role in cardiac inflammatory responses in acute myocardial infarction. IL-8, a chemotactic factor for neutrophils and T lymphocytes, which belongs to the C-X-C chemokine family, may also play important roles in atherogenesis 31 and myocardial ischemia/reperfusion injury. 32

Several studies have reported an interaction between ECs and mast cells. ECs regulate the survival and development of mast cells, 33 and mast cell tryptase stimulates the production of IL-8 and the expression of IL-1β gene of ECs. 34 No longer regarded simply as a passive barrier separating the blood and surrounding tissue, ECs are now recognized as key players in the process of inflammation by producing various biomolecules, including cytokines and chemokines. Mast cells are localized at the adventitia in atherosclerotic coronary arteries. Adventitial inflammation is recognized as an important promoting factor of atherogenesis and the progression of arteriosclerosis. 35 Pro-inflammatory effects of adventitial mast cells on ECs seen in this study suggest that the mast cells can play a role in atherosclerosis by stimulating ECs as effector cells. Moreover, mast cell tryptase released from adventitia may influence the function of remote intimal ECs via vasa vasorum circulation. Our study is the first to show that the degranulation of mast cells causes the production of MCP-1 in ECs. This observation may explain the link between mast cells and the development of atherosclerosis and heart failure via the production of chemokine by ECs.

MCGs contain a wide variety of inflammatory mediators, the release of which depends on the stimulus. These mediators include histamine, cytokines, and proteases, which have various effects on neighboring cells. 36 Tryptase, chymase, cathepsin G, and carboxypeptidase are the major proteases contained in MCGs. 37 Tryptase plays a role as is a growth factor for a number of cell types, including fibroblasts, epithelial cells, and smooth muscle cells. 38 It may also be implicated in angiogenesis, because it induces tubular formation of ECs. 39

Chymase is closely associated with cardiovascular disorders. It is activated in pressure-overloaded hearts, is able to convert angiotensin I to angiotensin II independently of the angiotensin-converting enzyme, and plays a major role in the formation of angiotensin II. 40 Other proteases are known to have functions, which remain to be fully clarified.

The mechanism of chemokine production by ECs stimulated with mast cell tryptase is unclear. One possible mechanism involves activation of protease-activated receptors (PARs). Tryptase or thrombin cleaves the amino-terminal extracellular extension of the intact and inactivated receptor, exposing the amino terminus, which then functions as a receptor agonist, binding to a region of the receptor and activating it. Four subtypes of PAR have been cloned. The thrombin receptor (PAR-1) is expressed on ECs but does not appear to be activated by tryptase. PAR-2 is also expressed on ECs, and it may be activated by tryptase. 41 The effect of human mast cell tryptase on ECs inducing the production of chemokine may be mediated by this receptor. PAR-3 and PAR-4 can also be cleaved by thrombin. 42 However, little is known about the relationship between tryptase and these receptors.

In summary, we found that MCGs upregulate the secretion and gene expression of MCP-1 and IL-8 in human ECs. Human mast cell tryptase, but not chymase, is involved in the MCG-induced production of these chemokines. These results suggest that mast cells contribute to the pathogenesis of cardiovascular disorders, for instance by stimulating EC production of chemokines and enhancing local inflammation.

This work was supported by a research grant from the Ministry of Health and Welfare of Japan and a grant-in-aid for general scientific research from the Ministry of Education, Science, Sports, and Culture of Japan.


Molecular organization of rat prolactin granules: in vitro stability of intact and "membraneless" granules

Studies carried out on a number of secretory cell systems suggest that the specific cytoplasmic granules in which the secretion products are stored before their release are complex organelles which can possess a distinct molecular organization. For instance, it has been reported that in some granules the segregated secretion products are organized into crystalline structures (1-3) or large intermolecular aggregates (4-8). It is likely that all phenomena of this type are favorable to the economy of the cell, in the sense that they reduce the energy required for storage of the secretion products. The prolactin (LTH) granules of the rat pituitary possess a number of morphological features which strongly suggest that the molecules(s) of their content might be arranged in a relatively stable structure. Thus, these granules are remarkably polymorphic in shape, and their membrane is usually separated from their content by a clear space. Furthermore, identifiable LTH granules devoid of their membrane are often seen in the pericapillary space, suggesting that upon discharge by exocytosis they are dissolved only slowly (9). However, no studies specifically concerned with the mechanisms of LTH storage have been reported so far. In order to obtain some information on this question, we have studied the behavior of isolated granule fractions incubated in vitro under a variety of carefully controlled experimental conditions.


Studies on Morphological Changes and Histamine Release Induced by Bee Venom, n-Decylamine and Hypotonic Solutions in Rat Peritoneal Mast Cells

Department of Histology, University of Umeå, the Department of Pharmacology, Karolinska Institutet, Stockholm, Sweden, and the Department of Connective Tissue Research Institute for Biological and Medical Sciences, Retina Foundation, Boston, U.S.A

Department of Histology, University of Umeå, the Department of Pharmacology, Karolinska Institutet, Stockholm, Sweden, and the Department of Connective Tissue Research Institute for Biological and Medical Sciences, Retina Foundation, Boston, U.S.A

Department of Histology, University of Umeå, the Department of Pharmacology, Karolinska Institutet, Stockholm, Sweden, and the Department of Connective Tissue Research Institute for Biological and Medical Sciences, Retina Foundation, Boston, U.S.A

Department of Histology, University of Umeå, the Department of Pharmacology, Karolinska Institutet, Stockholm, Sweden, and the Department of Connective Tissue Research Institute for Biological and Medical Sciences, Retina Foundation, Boston, U.S.A

Résumé

Histamine release and concomitant morphological changes in rat peritoneal mast cells were studied under various conditions. It was found that mast cells react somewhat differently, depending on the means by which histamine release was brought about. Bee venom produced effects similar to those of compound 48/80 and seemed to trigger an active cell process with extrusion of mast granules as a final result. m-Decylamine and hyposmotic solutions appeared to bring about histamine release by affecting the integrity of mast cell fine structure resulting in a breakdown of plasma membrane and cellular compartments.


GAGs and mast cell proteases

The proteases specific to mast cell granules are chymases, tryptases and carboxypeptidase A3 in human mast cells there is one chymase and a limited repertoire of tryptases compared with the numerous mouse enzymes [2]. In addition to these, several other proteases occur in mast cell granules but are not specific to them examples are cathepsin G, granzyme B [2], and cathepsin E, which cleaves the carboxypeptidase A precursor to give the active enzyme [38]. Proteases in mast cell granules are stored in their active forms [39]. The functions of mast cell proteases in inflammation and tissue repair [40], and those of protease-proteoglycan complexes in innate immunity [41] have been reviewed. These proteases are well recognised as pharmacological targets [42].

Mast cell protease storage is dependent on serglycin, and is moreover dependent on the presence of heparin and/or chondroitin, as demonstrated in NDST2 −/− mice that do not make the fully sulphated heparin structure [43, 44] and GalNAc4S-6OST −/− mice that cannot generate the CS-E structure [45]. No evidence has been reported that fully anticoagulant heparin, containing the 3-OST product sequence, is necessary for protease storage. Mouse CTMCs deficient in a combination of proteases have much reduced heparin, but unaltered chondroitin content [46]. Protease deficient, serglycin deficient, and heparin deficient mast cells all display altered granule morphology [43, 44, 46, 47].

In the mast cell granule, proteases and heparin are in intimate contact, so extensive heparin binding sites containing basic residues are expected on the surfaces of the proteases. For tryptases, dependent on heparin for activity and stabilisation of the tetrameric form [48], a plausible cross-linking geometry has been described for human β-II tryptase [49] (Fig. 4a) and a potentially heparin-binding linear area of basic character has been identified across two monomeric units in the tetramer of human α1-tryptase (Fig. 4b) [50]. Besides the active tetrameric form, stabilised by heparin, tryptases such as human β-tryptase and mouse mMCP-6 can also form active monomers in the presence of heparin, even if the heparin chain is too small to bridge two protein monomers (though heparin of such a low molecular weight is not likely to be found in vivo) [51, 52]. The minimum length of heparin for complex formation with tryptase tetramer is 20 monosaccharides [53]. The substrate selectivities for monomeric and tetrameric tryptases are different, and the monomeric form is susceptible to inhibition by protein inhibitors such as BPTI [51] in the tetrameric form the active sites of the four monomers face each other round a restricted space in the centre of the complex, restricting access to inhibitors that are proteins.

Heparin interactions with proteases a A β-tryptase tetramer crystal structure (1A0L.pdb), coloured by charge where blue is positive and red negative. This view clearly shows the restricted central active site. Clusters of basic residues, coloured blue, might accommodate a heparin chain binding to two monomers and so stabilising the active tetramer. Diagram made in Discovery Studio Visualiser, Accelrys Software Inc. b An α-tryptase tetramer crystal structure (1LTO.pdb), turned over by 90° to show the equivalent of the top face as compared with A). This view shows an almost continuous line of basic amino acid residues aligning with a long heparin molecule, shown in ball and stick format. Reproduced from [50] with permission. c A chymase monomer crystal structure (4KP0.pdb), showing clusters of basic amino acid residues (blue) on opposite sides of the charge-coloured surface, with a cluster of acidic residues (red) between them. The orientation of these two basic patches on the surface of chymase might allow this enzyme to pack between heparin chains of serglycin. The active site groove is on the left face of this diagram. Diagram made in Discovery Studio Visualiser, Accelrys Software Inc. A granzyme B monomer crystal structure (1IAU.pdb) showing a substantial cluster of basic residues (blue) at the top of the charge-coloured surface. The active site is on the left face of the diagram. Diagram made in Discovery Studio Visualiser, Accelrys Software Inc

As the tetramer is most stable at low pH and in the presence of heparin, it has been proposed that tryptases are stored in the tetrameric form [54], and the presence of two separate, linear heparin binding sites on each tetramer, requiring long heparin chains, is compatible with the formation of closely packed complexes with heparin chains attached to a serglycin core. Depolymerisation of heparin, degranulation, and rise in pH could dissociate the tetramers to give heparin-activated, effective monomers, or inactive monomers as the heparin dissociates over time.

It is interesting to note that antithrombin is capable of inhibiting the monomeric active form of tryptase [55] so heparin can either activate the serine protease or potentiate its inhibition if all three are found together. Tetrameric, heparin-associated human tryptase can prevent coagulation and formation of fibrin deposits in inflamed tissue by cleaving fibrinogen [56].

For human chymase and granzyme B, typical heparin/HS binding sites can be identified. Chymase is active as a monomer, and does not require heparin for its activity. It has two separate well-defined patches of basic residues that may constitute heparin-binding sites, on opposite faces of the protein surface (Fig. 4c). There is only one human chymase (rodents have several), and its presence or absence determines the classification of human mast cells into MCCT mast cells, positive for both tryptase and chymase, and MCT cells, positive for tryptase only [2]. These two cell types are considered approximately equivalent to rodent CTMCs and MMCs, respectively. It is likely that this classification is an oversimplification of the true situation, at least in tissues like the lung [57]. Granzyme B has a particularly clear basic patch, shown on the protein surface in Fig. 4d. All of these potential heparin binding sites on the proteases have different sizes and shapes they may have different affinities for heparin, different abilities to bind to more than one heparin chain in the granule, different requirements in terms of heparin chain length, and even possibly different preferences for fine structure within heparin. It is also possible, of course, that preferences for CS/DS structures vs heparin structures differ between proteases.


Méthodes

Stocks et embryons de poisson zèbre

Les poissons zèbres ont été accouplés, mis en scène et élevés comme décrit précédemment 14 et maintenus conformément aux directives du comité institutionnel de protection et d'utilisation des animaux de l'Université de Californie, de San Diego ou du comité institutionnel de protection et d'utilisation des animaux de l'Oregon State University. Les lignées transgéniques Tg(gata2:eGFP) la3 15 et Tg(mpx:eGFP) i113 16 ont été utilisés.

Cell preparation

Des suspensions unicellulaires de WKM et de rate ont été préparées à partir de poisson zèbre adulte comme décrit. 15 Le sang a été obtenu par ponction cardiaque avec embouts héparinés après décès en tricaïne. Les cellules d'exsudat intrapéritonéal (IPEX) ont été recueillies par lavage avec une solution saline tamponnée au phosphate (PBS Mediatech). Quatre lavages séquentiels utilisant 5 L de PBS ont été effectués à l'aide d'une seringue de 10 L (Hamilton) pour un volume total de 20 L. Des suspensions unicellulaires provenant d'autres organes ont été préparées par trituration et filtration manuelles. Les comptages cellulaires ont été effectués à l'aide d'un hématimètre (Hausser Scientific), en utilisant du Trypan Blue (Invitrogen).

Cytométrie en flux

Les cellules ont été examinées à l'aide d'un cytomètre en flux LSRII (BD Biosciences) comme décrit précédemment. 15,17 Les données ont été analysées à l'aide du logiciel FlowJo version 9.0.2 (TreeStar). Les cellules ont été purifiées en utilisant un FACSAria I (BD Biosciences).

Cytologie

Les cytospins ont été réalisés comme décrit 15 en utilisant un Shandon Cytospin-4 (Thermo Fisher Scientific). Les cellules ont été fixées et colorées avec de l'hématoxyline et de l'éosine (Thermo Fisher Scientific), Wright-Giemsa (WG), la myéloperoxydase (MPX), l'acide périodique-Schiff (PAS) ou le bleu de toluidine (TB) selon les instructions du fabricant (Sigma-Aldrich ). Les frottis sanguins ont été colorés au PAS, avec de l'hématoxyline comme contre-coloration.

Microscopie

Les cytospins ont été imagés à l'aide d'un microscope DP70 (Olympus America). Pour la microscopie électronique à transmission (MET), les cellules ont été fixées dans du glutaraldéhyde à 3 % dans du tampon cacodylate 0,1 M. Les cellules ont été incluses dans 12% de gélatine/PBS et sédimentées. Des pastilles de gélatine ont été fixées dans du tétroxyde d'osmium tamponné à 1 %, lavées et déshydratées dans une série d'éthanol gradué et passées à travers de l'oxyde de propylène. Les échantillons ont été incorporés dans Embed 812/Araldite (Electron Microscopy Sciences). Des sections minces (60 nm) ont été découpées et montées sur des grilles revêtues de parlodion et colorées avec de l'acétate d'uranyle et du citrate de plomb pour examen sur un microscope électronique Philips-CM100 (Philips/FEI) à 80 kV. Les images ont été obtenues à l'aide d'un appareil photo Megaview-III (Olympus America) et traitées à l'aide d'Adobe Photoshop CS.

Réaction en chaîne par polymérase quantitative en temps réel

L'ARN a été obtenu en utilisant Trizol (Invitrogen) selon les instructions du fabricant. La contamination génomique a été évitée par un traitement à la DNAse (Roche Diagnostics). L'ADNc a été préparé en utilisant un kit Superscript-III First-Strand (Invitrogen) avec une réaction de contrôle séparée sans transcriptase inverse. L'amplification en chaîne par polymérase quantitative a été réalisée à l'aide d'un mélange maître Brilliant SYBR Green (Stratagene) et d'un système Mx3000P (Stratagene). Les échantillons ont été amplifiés en triple. La taille du produit de réaction a été confirmée par électrophorèse sur gel. Les amorces ont été conçues avec le logiciel Primer3 version 0.4.0 18 ou comme indiqué (ef1, 19 gata2, 19 et mpx 19 ). dr-rnasel2 : avant, TTCTGGGCTTTATTCACAAC arrière, TGAAAGAGAAGCTGAAGACC gcsfr, avant, TGAAGGATCTTCAACCACAC arrière, GGGAATTATAGGCCCACAAAC ccr9, avant, AACCTCACTCACTCCTCAAAC arrière, CAGACCACCAGAGAGTGTTACC mhc2dab, vers l'avant, CAGGCCTACTTGCATCAATTG vers l'arrière, CAGACCAGATGCTCCGATG.

Préparation du HpAg

Six souris Swiss Webster femelles (20 g, 6-8 semaines) ont été gavées avec 150 H polygyre larve de troisième stade (L3) dans de l'eau bidistillée filtrée à 0,1 μm (ddH2O). Au jour 22 après l'infection, les souris ont été tuées et les intestins grêles ont été prélevés et coupés en 3 sections dans 0,15 M de NaCl, et incubés à 37° pendant 2 heures. Adulte H polygyre (> 200) ont été transférés avec un cure-cils dans ddH2O dans un tube de microcentrifugation, culotté pendant 45 secondes à 300g, lavé et repoussé. Les adultes ont été surgelés dans de l'azote liquide et conservés à -80°C. Les extraits ont été préparés à l'aide d'un sonicateur (Sonifier 450 Branson), et les suspensions résultantes ont été centrifugées à 4000g et stérile 0,22 µm filtré (Millipore). La concentration en protéines a été déterminée en utilisant le dosage des protéines à l'acide bicinchoninique (Pierce Chemical). Les extraits ont été conservés à -80°C.

Essai de dégranulation

Les cellules ont été distribuées dans une plaque 96 puits et incubées pendant 2 heures à 32°C et 5% CO2 with media 20 containing HpAg or PBS, or lysed with 0.2% Triton-X gata2:eGFP les cellules hi ont été étalées à 1 × 10 5 cellules/mL. Les surnageants acellulaires ont été collectés et ajoutés à 500 L d'o-phénylènediamine (OPD) (Sigma-Aldrich) dans un tampon phosphate-citrate 0,05 M et 30 % de peroxyde d'hydrogène pour évaluer la dégranulation. 21 Les réactions ont été arrêtées après 10 minutes avec 4M H2DONC4, et dosé par spectrophotométrie (SPECTRAmax PLUS384) à 492 nm.

Test de sensibilisation

Transgénique gata2:eGFP animals were immunized weekly by intraperitoneal injection with 2 μg of papain (Sigma-Aldrich), or 0.5 μg of HpAg, emulsified in incomplete Freund adjuvant (IFA Sigma-Aldrich), followed by another intraperitoneal injection with emulsified antigen a day before the collection of tissues, after 1 or 4 weeks. Les poissons témoins ont été soit traités par injection intrapéritonéale avec du PBS dans l'IFA (véhicule) soit laissés non traités (non injectés). Des suspensions unicellulaires provenant de la rate et du sang de poissons traités et non traités ont été préparées comme décrit dans « Préparation des cellules ».

P tomentosa test d'infection

P tomentosa l'infection du poisson zèbre adulte a été réalisée comme décrit précédemment. 8 Les poissons ont été déminéralisés et des coupes histologiques de poissons individuels ont été préparées, les lames étant colorées au PAS pour identifier les éosinophiles. L'infection a été confirmée en observant la présence de larves en développement dans l'épithélium intestinal et la lumière. Les éosinophiles ont été quantifiés en comptant toutes les cellules PAS + nucléées visibles dans 25 champs individuels à fort grossissement (grossissements 1 000 fois) du tractus gastro-intestinal des animaux infectés et non infectés.

Statistiques

Les données ont été analysées avec un étudiant bilatéral t essais. Les différences ont été jugées significatives à P valeurs inférieures à 0,05.


Molecular cloning of human cathepsin G: structural similarity to mast cell and cytotoxic T lymphocyte proteinases

Les vues d'articles correspondent à la somme conforme à COUNTER des téléchargements d'articles en texte intégral depuis novembre 2008 (à la fois PDF et HTML) dans toutes les institutions et tous les individus. Ces mesures sont régulièrement mises à jour pour refléter l'utilisation au cours des derniers jours.

Les citations sont le nombre d'autres articles citant cet article, calculé par Crossref et mis à jour quotidiennement. Trouvez plus d'informations sur le nombre de citations de Crossref.

L'Altmetric Attention Score est une mesure quantitative de l'attention qu'un article de recherche a reçu en ligne. Cliquer sur l'icône en forme de beignet chargera une page sur altmetric.com avec des détails supplémentaires sur le score et la présence sur les réseaux sociaux pour l'article donné. Trouvez plus d'informations sur le score d'attention Altmetric et comment le score est calculé.

Noter: Au lieu d'un résumé, il s'agit de la première page de l'article.


Voir la vidéo: Cytology case discussion (Septembre 2022).