Informations

Lorsque la longueur des télomères est mesurée, la méthode est-elle effectuée sur une collection de cellules donnant une moyenne ?

Lorsque la longueur des télomères est mesurée, la méthode est-elle effectuée sur une collection de cellules donnant une moyenne ?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Quelles sont les méthodes utilisées pour mesurer les télomères chez les sujets humains ou animaux ?

Peut-on le faire sur une cellule individuelle ?

La préoccupation suivante a-t-elle déjà été soulevée et traitée :

Que se passe-t-il s'il existe une variation naturelle de la longueur des télomères cellule par cellule et que diverses méthodes existent (exercice intense, etc.) qui exercent une pression de sélection sur la longueur des télomères, alors si la méthode de mesure implique d'une manière ou d'une la longueur moyenne augmente alors que quelque chose d'autre s'est réellement produit. Il en résulte que toutes ces études concluent que la longueur des télomères a augmenté.


Un télomère peut être mesuré à l'aide d'un test flow-fish. Fondamentalement, des marqueurs fluorescents qui se lient à l'ADN sont introduits dans le noyau d'une cellule, puis ces marqueurs peuvent être comptés à l'aide d'une cytométrie en flux d'appel de méthode.

Cela peut être fait sur une seule cellule

Je ne suis pas sûr de comprendre la dernière partie de la question, mais je peux dire que si la taille moyenne des télémores augmente dans une taille d'échantillon particulière, les scientifiques ne concluront rien sur la base de ces données.

S'il y avait une conclusion scientifique sur la taille des télomères par rapport aux pressions sélectives externes, il y aurait des données statistiquement significatives qui rendraient correctement compte des variations observées dans différentes cellules.


Une méthode PCR quantitative pour mesurer la longueur absolue des télomères

Nous décrivons une méthode simple et reproductible pour mesurer la longueur absolue des télomères (aTL) en utilisant la réaction en chaîne par polymérase quantitative en temps réel (qPCR). Cette méthode est basée sur la méthode de Cawthon pour la mesure relative de la longueur des télomères (TL) mais modifiée en introduisant un standard oligomère pour mesurer l'aTL. La méthode décrit les standards d'oligomères, la génération de la courbe standard et les calculs nécessaires pour calculer l'aTL à partir des données qPCR. Les contrôles nécessaires et les caractéristiques de performance du dosage sont décrits en détail et comparés par rapport à d'autres méthodes de mesure de la TL. Les résultats typiques de ce test pour une variété d'échantillons de tissus humains sont fournis ainsi qu'un programme de dépannage. Cette méthode permet une mesure à haut débit d'aTL en utilisant de petites quantités d'ADN, ce qui la rend propice aux études épidémiologiques moléculaires. Par rapport aux dosages traditionnels relatifs TL qPCR, la méthode aTL décrite dans ce protocole permet une comparaison plus directe des résultats entre les expériences au sein et entre les laboratoires.


Fond

Il est largement admis que les femmes ont des télomères plus longs que les hommes, bien que les résultats des études aient été contradictoires.

Méthodes

Nous avons réalisé une revue systématique et des méta-analyses pour tester l'hypothèse selon laquelle chez l'homme, les femmes ont des télomères plus longs que les hommes et que cette association devient plus forte avec l'âge. Des recherches ont été menées dans EMBASE et MEDLINE (en novembre 2009) et des ensembles de données supplémentaires ont été obtenus auprès des chercheurs de l'étude. Les études d'observation éligibles ont mesuré les télomères pour les femmes et les hommes de tout âge, avaient une taille d'échantillon minimale de 100 et comprenaient des participants ne faisant pas partie d'un groupe malade. Nous avons calculé des estimations sommaires à l'aide de méta-analyses à effets aléatoires. L'hétérogénéité entre les études a été étudiée à l'aide d'une analyse de sous-groupe et d'une méta-régression.

Résultats

Les méta-analyses de 36 cohortes (36 230 participants) ont montré qu'en moyenne les femmes avaient des télomères plus longs que les hommes (différence standardisée de longueur des télomères entre les femmes et les hommes 0,090, IC à 95 % 0,015, 0,166 ajusté en fonction de l'âge). Il y avait peu de preuves que ces associations variaient selon le groupe d'âge (p = 1,00) ou le type de cellule (p = 0,29). Cependant, la taille de cette différence variait selon les méthodes de mesure, avec seulement le Southern blot mais ni la PCR en temps réel ni le Flow-FISH ne montrant une différence significative. Cette différence n'était pas associée à une erreur de mesure aléatoire.

Conclusion

La longueur des télomères est plus longue chez les femmes que chez les hommes, bien que cette différence n'ait pas été universellement trouvée dans les études qui n'ont pas utilisé les méthodes de transfert de Southern. Des recherches supplémentaires sur les explications des différences méthodologiques sont nécessaires.


Les télomères du stress

Les télomères protègent l'intégrité des chromosomes. Ils raccourcissent à chaque division cellulaire dans la plupart des cellules, car la télomérase n'est pas active dans la grande majorité des cellules humaines [10]. On pourrait dire qu'ils se "sacrifient". D'autant plus que la perte d'une séquence télomérique n'est pas aussi critique pour l'état métabolique actuel d'une cellule que la perte de la séquence d'ADN codant pour une protéine. reconnus comme des cassures double brin de l'ADN, qui, à leur tour, alerteraient les mécanismes de réparation de l'ADN [11]. Cependant, avec le temps, la longueur des télomères dans les cellules normales diminue jusqu'à devenir trop courtes pour jouer leur rôle et garder les cellules capables de se diviser. entraîne une sénescence cellulaire qui est l'une des causes majeures du vieillissement et des troubles liés au vieillissement [12] associés au problème de réplication terminale (limite de Hayflick) [13].

L'expression et l'activité de la télomérase dans les cellules humaines diminuent avec l'âge [14]. Cependant, il s'agit d'un phénomène individuel et le taux d'attrition des télomères est associé, entre autres, à la capacité à vaincre le stress. Comme suggéré, l'activité physique (perçue comme l'un des principaux moyens d'atténuer le niveau de stress) est associée à un vieillissement en bonne santé et à une réduction du risque de plusieurs troubles chroniques, probablement en raison de la restauration des télomères [15, 16]. Au niveau cellulaire, le stress fait référence aux facteurs qui peuvent affecter le métabolisme ou endommager la cellule. Cependant, quel que soit le niveau, le stress s'accumule progressivement avec le vieillissement et peut affecter négativement la santé et le bien-être de l'individu. Fait important, il a été démontré que les antioxydants retardent le début de la sénescence vasculaire d'une manière dépendante de la télomérase. Dans une étude in vitro, il a été démontré que les espèces réactives de l'oxygène (ROS) diminuaient le niveau de protéine nucléaire hTERT (transcriptase inverse de la télomérase humaine) (la sous-unité clé de la télomérase) et l'activité de la télomérase dans les cellules endothéliales, ce qui a été suivi d'un développement de phénotype sénescent . Dans le même temps, l'incubation avec l'antioxydant N-acétylcystéine a bloqué cette exportation nucléaire de hTERT dans le cytosol, suggérant son rôle dans la réponse au stress [17]. Il a été démontré qu'un autre antioxydant bien connu, l'a-tocophérol, réprime le raccourcissement des télomères et conserve l'activité de la télomérase dans les endotheliocytes microvasculaires cérébraux [18]. De même, il a été démontré que l'extrait de Ginko Biloba (à fort potentiel antioxydant) retarde l'apparition de la sénescence en activant la télomérase via la voie de signalisation PI3k/Akt [19, 20]. Il est important de noter que le stress chronique entraîne une sécrétion accrue de cortisol capable de supprimer l'activation de la télomérase dans le système immunitaire et, par conséquent, de favoriser l'attrition des télomères [21].

En effet, le vieillissement s'accompagne d'une attrition des télomères, bien que son taux soit très hétérogène entre individus, différents types de cellules mais aussi différents chromosomes [22]. Le dernier aspect en particulier conduit à la conclusion que les cellules peuvent subir une sénescence prématurément, même lorsque la longueur moyenne des télomères est « normale », mais que certaines extrémités chromosomiques spécifiques sont extrêmement courtes. Comme il existe certaines voies biochimiques communes au vieillissement, à la réponse au stress et à l'attrition des télomères, nous pensons que les extrémités des chromosomes sont des marqueurs de stress très sensibles et des indicateurs fiables du vieillissement cellulaire. Cependant, il semble que la seule façon de reconnaître la longueur des télomères comme un marqueur de sénescence/vieillissement/exposition au stress est d'évaluer la longueur/taux d'attrition des chromosomes individuels et de ne pas mesurer la longueur totale des télomères en moyenne.

Un autre rapport crucial a été démontré par Garrett-Bakelman et al., qui ont démontré une étude associée à l'exposition à une gravité réduite. Comme indiqué, un astronaute (Scott Kelly), qui a passé près d'un an dans la station spatiale internationale, a souffert de syndromes graves (diminution de la masse corporelle, instabilité de son génome, gonflement des principaux vaisseaux sanguins, modifications de la forme des yeux, modifications du métabolisme, inflammation et altérations de son microbiome) mais aussi un allongement important des télomères. Il est important de noter que le chromosome se termine à nouveau raccourci après l'atterrissage de l'astronaute et est revenu presque à des niveaux de prévol dans les 6 mois suivant son retour sur Terre. Cependant, l'augmentation du nombre de télomères courts a été observée, et l'expression de certains gènes était encore perturbée. Dans le même temps, son frère jumeau identique (n'a pas passé le temps dans l'espace) a été suivi comme référence ne montrant aucune altération significative de la longueur des télomères [23]. Ce cas montre à quel point la régulation des télomères est complexe.


Méthodes

Sujets et contrôles

Étude sur la santé pulmonaire (LHS). L'étude a utilisé des données cliniques et du matériel biologique obtenus dans le cadre de la Lung Health Study (LHS), un essai clinique parrainé par le National Heart, Lung and Blood Institute. Après réception d'un consentement éclairé écrit, le LHS a initialement recruté 5887 fumeurs, âgés de 35 ans et présentant une limitation légère à modérée du débit d'air (défini comme un rapport de volume expiratoire forcé à une seconde (VEMS)1) à la capacité vitale forcée (CVF)𢙀.70 et 55㳾V1㲐% prédit) dans 10 centres en Amérique du Nord [15]. Personnes ayant des antécédents de cancer (sauf carcinome in situ ou carcinome basocellulaire de la peau), infarctus du myocarde (au cours des deux dernières années), angine de poitrine, insuffisance cardiaque, accident vasculaire cérébral (au cours des deux dernières années), insuffisance rénale, insulinothérapie nécessitant un diabète sucré, une cirrhose ou d'autres maladies hépatiques graves, une embolie pulmonaire, des troubles du système nerveux central, un glaucome à angle fermé ou toute autre maladie majeure qui aurait pu compromettre le suivi ont été exclus [16].

Au cours des 5 premières années de suivi, la fonction pulmonaire et le statut tabagique des participants ont été évalués chaque année. Les participants ont été classés comme ayant cessé de fumer régulièrement s'ils étaient des non-fumeurs validés à chaque visite annuelle. Les participants qui étaient fumeurs à chaque visite annuelle étaient des fumeurs continus. Ceux dont le comportement tabagique variait ont été classés comme fumeurs intermittents. À l'année 5, 4 803 participants ont fourni des échantillons de sang (représentant 89% des participants éligibles). Les échantillons de sang ont été séparés en leurs composants et ont été stockés dans des congélateurs �ଌ jusqu'à utilisation. Les participants à l'étude ont ensuite été suivis passivement jusqu'à la fin de 2001 pour un suivi médian de 7,5 ans à partir de la date de la ponction veineuse jusqu'à la clôture de l'étude. Au cours du suivi, l'état vital et les hospitalisations des participants ont été enregistrés. Un comité de mortalité et de morbidité a examiné tous les dossiers des patients, y compris les certificats de décès, les témoignages oculaires, les dossiers d'autopsie, les résumés des entretiens avec les médecins traitants et les dossiers d'hospitalisation et a attribué une cause à la mortalité pour tous les défunts. Ces données ont été complétées par un National Death Index qui a fourni la date et la cause du décès pour tous les participants à l'étude américaine [16]. Les critères de mortalité ont été regroupés en : maladie coronarienne, maladie cardiovasculaire (qui comprenait également la maladie coronarienne), cancer du poumon, tous les cancers (qui comprenait le cancer du poumon), maladie respiratoire à l'exclusion du cancer du poumon, autres et inconnu.

Cohorte d'étude sur le vieillissement en bonne santé. Pour comparer les longueurs des télomères des sujets atteints de BPCO dans le LHS à un groupe témoin sans BPCO, nous avons utilisé les données des télomères de sujets d'âge moyen de l'étude Healthy Aging, qui avaient entre 40 et 50 ans et ont été recrutés au hasard sans tenir compte de la santé ou statut de la maladie (c.-à-d. témoins “négatif”) [17].

Advair, cohorte Biomarqueurs dans la BPCO (ABC). En tant que deuxième groupe de contrôle (c.1/Rapport CVF inférieur à 70% et VEMS1 moins de 80 % des personnes prédites, qui avaient au moins 10 paquets d'antécédents de tabagisme et étaient âgés d'au moins 40 ans [18]. Les résultats de cette étude ont déjà été publiés [13].

Extraction d'ADN de leucocytes

La concentration d'ADN du sang périphérique prélevé à l'année 5 a été déterminée à l'aide d'un spectrophotomètre NanoDrop 8000 (Thermo Scientific, Wilmington, USA). Les échantillons d'ADN ont été dilués à 1 ng/µL dans du tampon Tris-EDTA 1× et stockés à �ଌ pour une utilisation ultérieure dans la réaction en chaîne de la polymérase quantitative (qPCR).

Mesure de la longueur des télomères

Les télomères des leucocytes du sang périphérique ont été mesurés à l'aide d'un protocole qPCR modifié décrit par Cawthon [19]. Les séquences d'amorces (écrites 5′𡤣′) étaient : tel 1, GGTTTTTGAG -GGTGAGGGGTGAGGGTGAGGGTGAGGGT tél 2, TCCCGACTATCCCTATCCCTATCCC -TATCCCTATCCCTA 36B4u, CAGCAAGTGGGAAGGTGTAATCC 36B4d, CCCATTCTA -TCATCAACGGGTACAA. Le gène à copie unique de référence utilisé était 36B4 et les concentrations finales des amorces (Sigma, The Woodlands, TX) étaient tel 1, 270 nM tel 2, 900 nM, 36B4u, 300 nM 36B4d, 500 nM.

La mesure de la longueur des télomères a été effectuée en triple pour tous les échantillons dans une plaque de réaction optique claire à 384 puits (Applied Biosystems, Foster City, CA). L'ADN de référence obtenu du Coriell Institute (Camden, NJ) a été dosé en triple sur chaque plaque PCR pour tenir compte de la variation de mesure interplaque. Chaque puits contenait 10 µL QuantiTect SYBR Green PCR Master Mix (QIAGEN, Mississauga, ON) et une concentration finale d'ADN de 0,25 ng/µL. Après chargement, les plaques ont été scellées avec un film adhésif optique MicroAmp (Applied Biosystems, Foster City, CA) et centrifugées brièvement à 2 500 tr/min. Les réactions ont été effectuées dans un système de détection de séquence ABI PRISM 7900HT (Applied Biosystems, Foster City CA). Le profil de cycle thermique pour l'amplification des télomères et des gènes à copie unique a commencé à 50 °C pendant 2 minutes, puis à 95 °C pendant 2 minutes. Pour la PCR des télomères, il a suivi 30 cycles de 95ଌ pendant 15 s et 54ଌ pendant 2 min. Le profil de cycle 36B4 a été suivi de 35 cycles de 95ଌ pendant 15 s et 58ଌ pendant 1 min. La longueur des télomères a été quantifiée en tant que rapport relatif T/S (T = telomere, S = single copy gene), calculé selon la formule de Cawthon [19].

Analyses statistiques

Les longueurs des télomères des leucocytes du sang périphérique ont été standardisées par rapport au gène de référence à copie unique (T/S). À des fins d'analyse, les participants ont été divisés en quartiles en fonction de leur rapport T/S. Les caractéristiques cliniques ont ensuite été comparées à l'aide d'un test du chi carré pour les variables dichotomiques (en utilisant les degrés de liberté appropriés) et du test de Cochran-Armitage pour la tendance des variables continues. Le critère d'évaluation principal de cette étude était la mortalité toutes causes confondues. Nous avons comparé le risque de mortalité toutes causes confondues dans les quartiles au cours de la période de suivi en utilisant une méthode de Kaplan-Meier (K-M) pour l'analyse univariée et un modèle à risques proportionnels de Cox pour l'analyse multivariée. Les courbes de survie K-M à travers les quartiles T/S ont été comparées à l'aide d'un test du log-rank. Dans le modèle multivarié, nous avons inclus les covariables suivantes : âge, sexe, indice de masse corporelle (IMC), statut tabagique au cours des 5 premières années de suivi, pack-années de tabagisme, pression artérielle à l'année 5 et VEMS1 à l'an 5. VEMS1, l'IMC, les mesures de la pression artérielle et les paquets-années de tabagisme n'ont pas affecté de manière significative les résultats du modèle. Ainsi, ils ont été abandonnés en dernière analyse. Une approche similaire a été utilisée pour les critères d'évaluation de la mortalité par cause. Les rapports T/S entre les groupes de fumeurs ont été comparés à l'aide du test de Kruskal-Wallis, car les données n'étaient pas distribuées normalement. Corrélations entre le rapport T/S et des variables telles que le VEMS1 à 5 ans et à l'âge ont été testés à l'aide du test de Spearman pour les variables non paramétriques. Les valeurs p inférieures à 0,05 (en utilisant un test bilatéral) ont été considérées comme significatives. Toutes les analyses ont été réalisées en utilisant SAS (version 9.1, Carey, N.C.). L'utilisation d'échantillons d'études LHS et ABC a été approuvée par le comité d'éthique de la recherche de Providence Health Care/UBC. L'utilisation d'échantillons de l'étude sur le vieillissement en santé a été approuvée par le comité d'éthique de la recherche clinique de l'UBC et de la British Columbia Cancer Agency.


Résultats

Les statistiques descriptives et les différences de groupe entre les variables de l' étude sont présentées dans le tableau 1 . Les corrélations bivariées sont présentées dans le tableau 2 . Comme le montrent ces tableaux, il y avait des différences de groupe en termes de poids à la naissance et de QI. De plus, le poids à la naissance, le QI et le sexe étaient associés de manière variable à la psychopathologie. Ainsi, nous avons réexécuté des modèles de cheminement séparés avec chacun le sexe, le QI et le poids à la naissance comme covariables et les résultats ne différaient pas substantiellement. Comme le montre le tableau 1, il n'y avait pas d'association directe entre la longueur des télomères à l'un ou l'autre point dans le temps et le statut du groupe –, que ce soit en comparant NIG à EIG, ou FCG à CAUG. Comme le montre le tableau 2, il y avait une stabilité de rang dans le TL au fil du temps, ce qui signifie que les individus avec des télomères plus courts à l'âge de 8 ans avaient tendance à avoir des télomères plus courts à l'âge de 12 ans par rapport à ceux avec des télomères plus longs. De plus, conformément aux études précédentes, il y avait un raccourcissement des télomères au fil du temps dans l'ensemble de l'échantillon, t (df ​​= 76) = 3,01, p = .004.

Tableau 1:

Caractéristiques et statistiques descriptives chez les enfants institutionnalisés et jamais institutionnalisés

Âge 8� Mesures
Tous les participantsEnfants institutionnalisés seulement
GIE (m= 96)NIG (m= 99)t ou χ 2 CAUG (m= 44)FCG (m= 52)t ou χ 2
Sexe masculin)52.1%48.5%.2552.351.9.001
Poids de naissance (g)2755.23208.05.06 *** 2847.52675.01.33
QI à pleine échelle80.2100.29.30 *** 78.281.91.29
Facteur général.45−.446.84 *** .51.40.57
Facteur d'intériorisation.04−.04.63.12−.02.69
Facteur d'extériorisation.00.00.06.06−.04.44
Longueur des télomères1.601.59.061.531.65.74
12 ans� Mesures
Tous les participantsEnfants institutionnalisés seulement
GIE (m= 112)NIG (m= 50)t ou χ 2 CAUG (m= 56)FCG (m= 56)t ou χ 2
Sexe masculin)51.846.0.4651.851.8<.001
Poids de naissance (g)2799.53244.94.29 *** 2878.62722.01.31
QI à pleine échelle72.398.19.00 *** 68.675.82.19 *
Facteur général.20−.444.29 *** .34.061.52
Facteur d'intériorisation−.05.111.22−.01−.09.58
Facteur d'extériorisation.16−.374.44 *** .23.10.63
Longueur des télomères1.401.43.641.381.41.59

Remarque : Toutes les statistiques sont des moyennes, à l'exception du sexe (%). Les variables générales, d'internalisation et d'extériorisation sont des scores factoriels avec une moyenne d'échantillon totale de zéro.

Le QI a été évalué à l'aide du WISC-IV. Le poids de naissance est mesuré en grammes. Les scores de longueur des télomères ne sont pas ajustés dans ce tableau.

Tableau 2:

Corrélations bivariées entre les variables de l'étude et d'autres caractéristiques de l'enfant

1.2.3.4.5.6.7.8.9.10.11.
1. Facteur général (8 ans & 0201310)
2. Facteur d'intériorisation (8 ans & 0201310).00
3. Facteur d'extériorisation (8 ans & 0201310).00.02
4. Longueur des télomères (8 ans & 0201310)−.02−.19 § .03
5. Facteur général (12 ans & 0201314).29 ** .00−.09.18
6. Facteur d'intériorisation (12 ans & 0201314)−.23 ** .12.04.03.15 §
7. Facteur d'extériorisation (12 ans & 0201314).37 *** −.04.06−.02.04−.25 **
8. Longueur des télomères (12 ans & 0201314)−.05−.25 ** .08.35 ** −.22 ** −.05−.01
9. Sexe (masculin).15 * −.07−.05.01.16 * .01.24 ** −.01
10. Poids à la naissance−.23 ** −.09.23 ** .01−.22 ** −.13−.11−.16 § .09
11. FSIQ (8 ans & 0201310)−.54 *** −.10.05.04−.08.34 ***
12. FSIQ (12 ans & 0201314)−.31 *** .12−.32 *** .02−.08.29 ** .90 ***

Compte tenu des résultats antérieurs des relations spécifiques au sexe entre la durée des soins institutionnels et la longueur des télomères, nous présentons des corrélations entre la durée passée dans les institutions parmi les EIG (pourcentage d'une vie jusqu'à un âge donné) et la longueur des télomères pour les hommes et les femmes. participants au tableau S1, disponible en ligne. Une plus grande durée de soins institutionnels à l'âge de 54 mois et de 8 ans était associée à une longueur des télomères plus courte à l'âge de 8 ans chez les participants masculins. Chez les participantes, une plus grande durée de soins institutionnels au départ et à 54 mois était associée à une plus courte longueur des télomères à l'âge de 12 ans et de 201314. Le temps passé en institution au fil du temps était corrélé (tableau S2, disponible en ligne). Lorsque la durée des soins en établissement et la longueur des télomères ont été examinées au sein du FCG et du CAUG (en tenant compte du sexe), une plus grande exposition aux soins en établissement à 54 mois, 8 ans et 12 ans était associée à une plus courte longueur des télomères à l'âge de 12 ans chez les CAUG, mais pas FCG (tableau S3, disponible en ligne). Les différences entre les sexes n'ont pas été examinées dans les groupes FCG et CAUG en raison de limitations de puissance. Nous développons ces résultats dans le supplément 1. Ainsi, il existe des associations entre la durée d'institutionnalisation et la longueur des télomères qui varient en fonction du sexe et de l'âge de l'évaluation plutôt que des associations directes entre le groupe d'institutionnalisation et la longueur des télomères. La forte relation entre le statut d'institutionnalisation (NIG = 0 EIG = 1) et la psychopathologie justifie son inclusion comme covariable dans le modèle primaire, décrit ci-dessous.

Association entre la longueur des télomères et la psychopathologie

Le modèle de chemin longitudinal décrivant la relation entre la longueur des télomères et les facteurs généraux, d'internalisation et d'extériorisation est présenté à la figure 1 . L'ajustement du modèle était acceptable : RMSEA = .069 [.02, .11], PCLOSE = .22, CFI = .90 et SRMR = .05. Les enfants EIG avaient une psychopathologie générale significativement plus élevée à l'âge de 8 ans que NIG, mais le statut d'institutionnalisation n'était pas lié à l'intériorisation ou à l'extériorisation à l'âge de 8 ans après avoir pris en compte le facteur général. De plus, il y avait une stabilité relative dans la psychopathologie générale au fil du temps, quel que soit le statut institutionnel, mais peu de stabilité dans l'intériorisation ou l'extériorisation après prise en compte de la stabilité du facteur général.

Noter. Les paramètres sont standardisés β coefficients. Les facteurs psychopathologiques sont des scores factoriels enregistrés à partir du modèle bifactoriel latent et utilisés comme variables manifestes. Seules les relations entre la longueur des télomères et la psychopathologie sont montrées. Voir le tableau 1 pour les associations entre les scores des facteurs psychopathologiques. EIG = groupe jamais institutionnalisé NIG = jamais institutionnalisé.

En terme de dans le temps associations, la longueur des télomères plus courte à l'âge de 8 ans était significativement associée à des problèmes d'intériorisation plus élevés, mais n'était pas liée à la psychopathologie générale ou à l'extériorisation. D'un autre côté, une longueur des télomères plus courte à l'âge de 12 ans était associée à une psychopathologie générale plus élevée, mais pas intériorisée ou extériorisée. Finalement, à travers le temps Les effets (c. Cet effet peut être interprété comme une psychopathologie d'internalisation plus élevée prédisant un changement de la longueur des télomères de l'âge de 8 ans à l'âge de 12 ans. Ni la psychopathologie générale ni la psychopathologie extériorisée à l'âge de 8 ans n'étaient associées à la longueur des télomères à l'âge de 12 ans et aucun effet réciproque de la longueur des télomères sur la psychopathologie n'est apparu. Tous les effets ont été testés simultanément et sous réserve de tous les autres effets du modèle. Comme il ne s'agissait pas de tests indépendants, aucune correction pour les tests multiples n'a été nécessaire.

Enfin, conformément à l'intention initiale de l'ECR, nous avons examiné si les associations entre les facteurs psychopathologiques et la longueur des télomères différaient entre : (i) EIG et NIG, et (ii) CAUG et FCG. Ce dernier modèle offrait un mauvais ajustement aux données, probablement en raison d'une puissance insuffisante compte tenu de la petite taille de l'échantillon des groupes CAUG et FCG. Les résultats de l'ancien modèle sont fournis dans le Supplément 1, disponible en ligne. Comme il n'y avait pas de différences observables dans les chemins reliant la psychopathologie et la longueur des télomères entre les enfants EIG et NIG, le modèle principal ci-dessus s'est effondré pour tous les enfants.


Remerciements

Cette revue est le résultat de discussions et de collaborations issues d'un atelier sur la dynamique des télomères chez les organismes non modèles. L'atelier a été soutenu par une subvention d'atelier internationale du BBSRC et un soutien supplémentaire de la Genetics Society et d'Agilent Technologies, ainsi que d'un prix de chercheur avancé du Conseil européen de la recherche décerné à PM. Nous remercions tous les participants à l'atelier pour leur contribution à nos discussions sur les méthodes de mesure des télomères, et à Abraham Aviv, Hannah Froy et François Criscuolo pour leurs commentaires sur les projets de manuscrits. DHN est soutenu par une bourse BBSRC David Phillips.

Nom de fichier La description
mee312161-sup-0001-TableS1.docxDocument Word, 16,1 Ko Tableau S1. Liste des espèces et des méthodes de stockage des tissus et d'extraction d'ADN et leur adéquation pour l'analyse ultérieure de la longueur des télomères, sur la base de l'expérience passée des auteurs et des communications personnelles avec des collègues. AE et TE font référence aux solutions tampons couramment utilisées : AE est un mélange d'acétate de sodium et d'EDTA, TE de solution de Tris et d'EDTA.

Remarque : L'éditeur n'est pas responsable du contenu ou de la fonctionnalité des informations fournies par les auteurs. Toute question (autre que le contenu manquant) doit être adressée à l'auteur correspondant à l'article.


Des documents électroniques supplémentaires sont disponibles en ligne à l'adresse https://doi.org/10.6084/m9.figshare.c.5001038.

Publié par la Royal Society sous les termes de la Creative Commons Attribution License http://creativecommons.org/licenses/by/4.0/, qui permet une utilisation sans restriction, à condition que l'auteur original et la source soient crédités.

Les références

. 2006 La dynamique des télomères relie-t-elle mode de vie et durée de vie ? Tendances Écol. Évol. 21, 47-53. (doi:10.1016/j.tree.2005.11.007) Crossref, PubMed, ISI, Google Scholar

. 2010 Les télomères et les histoires de vie : le long et le court de celui-ci . Anne. NY Acad. Sci. 1206, 130-142. (doi: 10.1111/j.1749-6632.2010.05705.x) Crossref, PubMed, ISI, Google Scholar

Haussmann MF, Marchetto NM

. 2010 Télomères : lier stress et survie, écologie et évolution . Cur. Zool. 56, 714-727. (doi: 10.1093/czoolo/56.6.714) Crossref, ISI, Google Scholar

Olsson M, Wapstra E, Friesen CF

. 2018 Écologie évolutive des télomères: une revue . Anne. NY Acad. Sci. 1422, 5-28. (doi: 10.1111/nyas.13443) Crossref, PubMed, ISI, Google Scholar

Olsson M, Wapstra E, Friesen CR

. 2018 Télomères ectothermiques : il est temps qu'ils rentrent du froid . Phil. Trans. R. Soc. B 373, 20160449. (doi: 10.1098/rstb.2016.0449) Lien, ISI, Google Scholar

Gomes N, Shay JW, Wright NOUS

. 2010 Biologie des télomères chez les métazoaires . FEBS Lett. 584, 3741-3751. (doi:10.1016/j.febslet.2010.07.031) Crossref, PubMed, ISI, Google Scholar

. 2015 Réparation par excision d'ADN aux télomères . Réparation de l'ADN 36, 137-145. (doi:10.1016/j.dnarep.2015.09.017) Crossref, PubMed, ISI, Google Scholar

. 2018 Dommages à l'ADN, réparation et maintien de la longueur des télomères : rôle des suppléments nutritionnels . Dans Mutagénicité : dosages et applications (éds

Kumar A, Dobrovolsky VN, Dhawan A, Shanker R

), p. 287-307. Amsterdam, Pays-Bas : Elsevier . Google Scholar

2017 Prévalence et étiologie du cancer chez les animaux sauvages et captifs . Dans Écologie et évolution du cancer (éds

Ujvari B, Roche B, Thomas F

), p. 11-46. Londres, Royaume-Uni : Academic Press . Référence croisée, Google Scholar

. 2009 Télomères et maladie . EMBO J. 28, 2532-2540. (doi: 10.1038/emboj.2009.172) Crossref, PubMed, ISI, Google Scholar

. 2012 Les syndromes télomériques . Nat. le révérend Genet. 13, 693-704. (doi: 10.1038/nrg3436) Référence croisée, PubMed, ISI, Google Scholar

Pierre RC, Horvath K, Kark JD, Susser E, Tishkoff SA, Aviv A

. 2016 Longueur des télomères et compromis cancer-athérosclérose . PLoS Genet. 12, e1006144. (doi: 10.1371/journal.pgen.1006144) Crossref, PubMed, ISI, Google Scholar

Barrett ELB, Richardson DS

. 2011 Différences sexuelles dans les télomères et la durée de vie . Cellule vieillissante 10, 913-921. (doi: 10.1111/j.1474-9726.2011.00741.x) Crossref, PubMed, ISI, Google Scholar

2014 Sexe et longueur des télomères : revue systématique et méta-analyse . Exp. Gérontol. 51, 15-27. (doi:10.1016/j.exger.2013.12.004) Crossref, PubMed, ISI, Google Scholar

Rollings N, Friesen CR, Sudyka J, Whittington C, Giraudeau M, Wilson M, Olsson M

. 2017 Dynamique des télomères chez un lézard avec investissement reproductif et auto-entretien spécifiques à la morphologie . Écol. Évol. 7, 5163-5169. (doi: 10.1002/ece3.2712) Crossref, PubMed, ISI, Google Scholar

Asghar M, Palinauskas V, Zaghdoudi-Allan N, Valkiunas G, Mukhin A, Platonova E, Farnert A, Bensch S, Hasselquist D

. 2016 Raccourcissement parallèle des télomères dans plusieurs tissus corporels en raison d'une infection palustre . Proc. R. Soc. Londres. Biol. Sci. 283, 20161184. (doi:10.1098/rspb.2016.1184) Lien, ISI, Google Scholar

Rollings N, Friesen CR, Whittington CM, Johansson R, Shine R, Olsson M

. 2019 Différences spécifiques au sexe et aux tissus dans la longueur des télomères chez un reptile . Écol. Évol. 9, 6211-6219. (doi:10.1002/ece3.5164) PubMed, ISI, Google Scholar

Benetos A, Kimura M, Labat C, Buchoff GM, Huber S, Labat L, Lu XB, Aviv A

. 2011 Un modèle de dynamique des télomères des leucocytes canins. Cellule vieillissante 10, 991-995. (doi: 10.1111/j.1474-9726.2011.00744.x) Crossref, PubMed, ISI, Google Scholar

Daniali L, Benetos A, Susser E, Kark JD, Labat C, Kimura M, Desai K, Granick M, Aviv A

. 2013 Les télomères se raccourcissent à des taux équivalents dans les tissus somatiques des adultes . Nat. Commun. 4, 1597. (doi: 10.1038/ncomms2602) Crossref, PubMed, ISI, Google Scholar

Reichert S, Criscuolo F, Verinaud E, Zahn S, Massemin S

. 2013 Corrélations de la longueur des télomères parmi les tissus somatiques chez les diamants mandarins adultes . PLoS UN 8, e81496. (doi: 10.1371/journal.pone.0081496) Crossref, PubMed, ISI, Google Scholar

. 2004 Hématologie des vertébrés inférieurs . Lors de la 55e réunion annuelle de l'American College of Veterinary Pathologists (ACVP) et de la 39e réunion annuelle de l'American Society of Clinical Pathology (ASVCP). Middleton, WI : Collège américain des pathologistes vétérinaires et Société américaine de pathologie clinique vétérinaire. Google Scholar

Beaulieu M, Benoit L, Abaga S, Kappeler PM, Charpantier MJE

. 2017 Attention à la cellule : la variation saisonnière de la longueur des télomères reflète les changements du profil leucocytaire . Mol. Écol. 26, 5603-5613. (doi:10/1111/mec.14329) Crossref, PubMed, ISI, Google Scholar

. 2009 Morphologie comparée, développement et fonction des cellules sanguines chez les vertébrés non mammifères . J. Exot. Animaux. Méd. 18, 87-97. Crossref, ISI, Google Scholar

. 2019 Physiologie des globules rouges et blancs . Anesth. Méd. de soins intensifs. 20, 170-174. (doi:10.1016/j.mpaic.2019.01.001) Crossref, ISI, Google Scholar

. 2002 Le stress oxydatif raccourcit les télomères . Tendances Biochem. Sci. 27, 339-344. (doi:10.1016/S0968-0004(02)02110-2) Référence croisée, PubMed, ISI, Google Scholar

Baerlocher GM, Lansdorp PM

. 2003 Mesures de la longueur des télomères dans des sous-ensembles de leucocytes par Flow-FISH multicolore automatisé. Cytométrie Partie A 55A, 1-6. (doi : 10.1002/cyto.a.10064) Référence croisée, ISI, Google Scholar

Carvalho de MP, Queiroz-Hazarbassanov NG, Massoco CO, Rossi S, Sant'Anna SS, Catão-Dias JL, Grego KF

. 2016 Caractérisation par cytométrie de flux des populations de leucocytes du sang périphérique de 3 espèces de serpents néotropicaux : Boa constrictor, Bothrops jararaca, et Crotalus durissus . Vétérinaire. Clin. Pathol. 45, 271-280. (doi: 10.1111/vcp.12358) Crossref, PubMed, ISI, Google Scholar

Carvalho de MPN, Queiroz-Hazarbassanov NGT, de Oliveira Massoco C, Sant'Anna SS, Lourenço MM, Levin G, Sogayar MC, Grego KF, Catão-Dias JL

. 2017 Caractérisation fonctionnelle des sous-ensembles de leucocytes du sang périphérique des serpents néotropicaux : mise en relation des caractéristiques des cellules de cytométrie en flux, des images de microscopie et des niveaux de corticostérone sérique. Dév. Comp. Immunol. 74, 144-153. (doi:10.1016/j.dci.2017.04.007) Crossref, PubMed, ISI, Google Scholar

Olsson M, Friesen CR, Rollings N, Sudyka J, Lindsay W, Whittington C, Wilson MR

. 2018 Effets à long terme du superoxyde et de la réparation de l'ADN sur les télomères des lézards. Mol. Écol. 27, 5154-5164. (doi: 10.1111/mec.14913) Crossref, PubMed, ISI, Google Scholar

Rollings N, Friesen CR, Sudyka J, Whittington C, Wilson M, Olsson M

. 2017 Dynamique des télomères chez un lézard avec investissement reproductif et auto-entretien spécifiques à la morphologie . Écol. Évol. 7, 5163-5169. (doi: 10.1002/ece3.2712) Crossref, PubMed, ISI, Google Scholar

Olsson M, Healey M, Wapstra E, Schwartz T, Lebas N, Uller T

. 2007 Variation du système d'accouplement et fluctuations de morphologie chez un lézard polymorphe. Mol. Écol. 16, 5307-5315. (doi: 10.1111/j.1365-294X.2007.03578.x) Référence croisée, PubMed, ISI, Google Scholar

Olsson M, Healey M, Wapstra E, Uller T

. 2009 Test de la qualité d'un porteur : une expérience de terrain sur des signaleurs lézards . Évolution 63, 695-701. (doi: 10.1111/j.1558-5646.2008.00569.x) Crossref, PubMed, ISI, Google Scholar

. 2009 Trop gros pour ses bottes : les coûts sociaux du maintien d'un statut dépendant de la condition sont-ils honnêtes chez un lézard australien ? Ecole Australe. 34, 636-640. (doi : 10.1111/j.1442-9993.2009.01968.x) Référence croisée, ISI, Google Scholar

. 2000 Chapter 21: Reptilian complete blood count . Dans Laboratory medicine: avian and exotic pets (ed.

), pp. 193-197. Philadelphia, PA : W.B. Saunders Company . Google Scholar

Stacy NI, Alleman AR, Sayler KA

. 2011 Diagnostic hematology of reptiles . Clin. Laboratoire. Méd. 31, 87-108. (doi:10.1016/j.cll.2010.10.006) Crossref, PubMed, ISI, Google Scholar

. 2008 Hematologic evaluation is mainstay of diagnosis for reptiles . Vétérinaire. Tech. 29, 616. Google Scholar

Nazarpour R, Zabihi E, Alijanpour E, Abedian Z, Mehdizadeh H, Rahimi F

. 2012 Optimization of human peripheral blood mononuclear cells (PBMCs) cryopreservation . Int. J. Mol. Cell. Méd. 1, 88-93. PubMed, Google Scholar

. 1991 Structure and function of telomeres . La nature 350, 569-573. (doi: 10.1038/350569a0) Crossref, PubMed, ISI, Google Scholar

Fischer U, Ototake M, Nakanishi T

. 1998 Lifespan of circulating blood cells in ginbuna crucian carp (Carassius auratus langsdorfii) . Fish Shellfish Immunol. 8, 339-349. (doi:10.1006/fsim.1998.0144) Crossref, ISI, Google Scholar

Asghar M, Hasselquist D, Hansson B, Zehtindjiev P, Westerdahl H, Bensch S

. 2015 Hidden costs of infection: chronic malaria accelerates telomere degradation and senescence in wild birds . Science 347, 436-438. (doi10.1126/science.1261121) Crossref, PubMed, ISI, Google Scholar

Angelier F, Costantini D, Blévin P, Chastel O

. 2018 Do glucocorticoids mediate the link between environmental conditions and telomere dynamics in wild vertebrates? Une critique . Gen. Comp. Endocrinol. 256, 99-111. (doi:10.1016/j.ygcen.2017.07.007) Crossref, PubMed, ISI, Google Scholar

Kurz DJ, Decary S, Hong Y, Trivier E, Akhmedov A, Erusalimsky JD

. 2004 Chronic oxidative stress compromises telomere integrity and accelerates the onset of senescence in human endothelial cells . J. Cell Sci. 117, 2417-2426. (doi:10.1242/jcs.01097) Crossref, PubMed, ISI, Google Scholar

Fouquerel E, Parikh D, Opresko P

. 2016 DNA damage processing at telomeres: the ends justify the means . Réparation de l'ADN 44, 159-168. (doi:10.1016/j.dnarep.2016.05.022) Crossref, PubMed, ISI, Google Scholar

Sardina JL, Lopez-Ruano G, Sanchez-Sanchez B, Llanillo M, Hernandez-Hernandez A


Design and methods

Setting and subjects

This analysis was performed within the framework of the Prevention of Renal and Vascular End-Stage Disease (PREVEND, www.prevend.org) study. The PREVEND study is an ongoing, longitudinal, general, population-based cohort study of individuals aged 28–75 years living in the city of Groningen, the Netherlands. For the present study, we included subjects who donated a full blood sample for DNA extraction at baseline (T1) and/or during the first (T2) and/or the second (T3) follow-up visit. Details of the study have been described previously 15 . In brief, 8592 subjects completed the baseline survey (1997–1998) and were invited to visit the outpatient department after approximately 4.3 years for the first and approximately 6.6 years for the second follow-up visit. At each visit, demographic and anthropometric characteristics and serum biomarkers were assessed. The PREVEND study has been approved by the local medical ethics committee and is being conducted in accordance with the guidelines of the Declaration of Helsinki. All participants provided written informed consent before enrolment.

Measurement of telomere length

Details of the methods of DNA extraction and of telomere length measurements are provided in the Appendix S1. In brief, all samples for DNA collected at different time-points were mixed and randomly extracted using a standard DNA extraction kit (QIamp, Qiagen, Venlo, the Netherlands) to neutralize potential batch effects. Mean relative leukocyte telomere length was measured using a monochrome multiplex real-time quantitative polymerase chain reaction technique (developed by R.M.C.) 16 . This technique enables the telomere-specific amplification and the single copy gene (reference) amplification to be carried out in a single reaction well with quantification measurements at different temperatures 16 . The ratio of telomere (T) to single copy gene (S) content (T/S ratio) is a relative measure of telomere length (RTL) and is expressed in arbitrary units (RTLU). All samples were measured in triplicate, and the average of the three runs was used to provide the mean RTLU for each individual. The intra-assay coefficients of variation were 2.0%, 1.9% and 4.5% for T, S and the T/S ratio, respectively.

We adhered to the arbitrary categorization of telomere trajectories as previously reported: shortening was defined as a >10% decrease in RTL, stable as a ≤10% change in RTL and elongation as a >10% increase in RTL at T3 compared to baseline 17, 18 .

Other measurements and definitions

All participants completed a questionnaire regarding demographic profile and smoking habits. Smoking was categorized as current smoking, previous smoking and nonsmoking. Body mass index (BMI) was calculated as weight (kg) divided by height squared (m 2 ) and categorized as follows: normal, <25 kg m −2 overweight, 25–30 kg m −2 and obese, ≥30 kg m −2 . Hypertension was defined as systolic blood pressure ≥140 mmHg, diastolic blood pressure ≥90 mmHg or the use of antihypertensive medication prehypertension was defined as systolic blood pressure <140 and ≥120 mmHg and diastolic blood pressure <90 and ≥80 mmHg and normotension was defined as both systolic blood pressure <120 mmHg and diastolic blood pressure <80 mmHg. Diabetes was defined as a fasting plasma glucose level of ≥126 mg dL −1 (7.0 mmol L −1 ), a nonfasting plasma glucose level of ≥200 mg dL −1 (11.1 mmol L −1 ) or the use of oral antidiabetic agents. Hypercholesterolaemia was defined as a total cholesterol level of ≥250 mg dL −1 (6.5 mmol L −1 ) or the use of lipid-lowering medication ≤200 mg dL −1 (5.13 mmol L −1 ) was considered an optimal cholesterol concentration. Estimated glomerular filtration rate (eGFR) was calculated using the Modification of Diet in Renal Disease (MDRD) study equation taking into account sex, age, ethnicity and serum creatinine levels 19 . Details of the measurement methods can be found in the Appendix S1.

Analyses statistiques

To obtain a normal distribution, telomere length was natural-log-transformed. Other continuous variables with a skewed distribution (creatinine, insulin, glucose, high-sensitivity C-reactive protein, cholesterol, HDL and triglycerides) were also natural-log-transformed prior to analysis. Individuals in the bottom and top 0.5% of the RTL distribution were excluded to limit the undue influence of outliers in the regression analysis. Differences in telomere lengths between groups were tested using Student's t-test or one-way anova . Cross-sectional associations between variables and telomere length were evaluated using standard linear regression models. Multivariate linear regression models were used to adjust for age and gender. To investigate telomere dynamics across time, two-level hierarchical growth models were constructed. Variables were centred around the grand mean (i.e. the mean was set to zero). Details of the model-building strategy, centring and multitest correction are provided in the Appendix S1.


Conclusion

Numerous observational studies of TL have been conducted among breast cancer patients in the last 20 years. Despite the major methodologic differences between studies, when considering all the studies (peripheral blood and tumor tissue) and all outcomes together, there was a trend toward an association of longer telomeres with a better prognosis. Further longitudinal studies with rigorous methodology, including proper control of confounding and an adequate TL measurement method, are still needed to determine the exact prognostic significance of TL for breast cancer patients.